ID: 1088925205

View in Genome Browser
Species Human (GRCh38)
Location 11:114294988-114295010
Sequence GCTGACTCCTTGGAAAAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088925200_1088925205 24 Left 1088925200 11:114294941-114294963 CCCTGGCATAAGGGCCACAACAA 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG 0: 1
1: 0
2: 1
3: 19
4: 191
1088925201_1088925205 23 Left 1088925201 11:114294942-114294964 CCTGGCATAAGGGCCACAACAAA 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG 0: 1
1: 0
2: 1
3: 19
4: 191
1088925202_1088925205 10 Left 1088925202 11:114294955-114294977 CCACAACAAAAGAGAGAGCGAAT 0: 1
1: 0
2: 0
3: 11
4: 200
Right 1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG 0: 1
1: 0
2: 1
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088925205 Original CRISPR GCTGACTCCTTGGAAAAAAC CGG Intronic
901382953 1:8887247-8887269 GCTGTCTCATTGGCCAAAACAGG + Intergenic
901790905 1:11653420-11653442 GCTGATCCCTGGGAAAAAGCAGG + Intronic
905198856 1:36302898-36302920 ACTGCCTCCTTGCATAAAACAGG + Intronic
905785384 1:40752024-40752046 GGTGACTCATCGGACAAAACAGG - Intronic
905921820 1:41724676-41724698 GCTGATACCATGGAAAAAACTGG + Intronic
906472356 1:46141779-46141801 GCTGACTCTTTTGGAAAGACAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907972109 1:59393273-59393295 GCTGTCTCCATGGAAAAGTCAGG + Intronic
908700747 1:66897639-66897661 GCTGACTCCTTGCCAAAATTTGG - Intronic
909224407 1:72998787-72998809 TGTGACTTCTTAGAAAAAACAGG + Intergenic
909671395 1:78192808-78192830 GCTGATTCTTAGAAAAAAACTGG - Intergenic
909950094 1:81708927-81708949 CCTGTCTCCTTGGAAAATAATGG - Intronic
912483145 1:110000647-110000669 ACTGACCCCTTGGAAATAAAGGG + Intronic
915476622 1:156156341-156156363 GCTGACTCCTGAGATAAAAGTGG - Intronic
916628091 1:166581579-166581601 GCTGAGTGCTGGGAATAAACAGG + Intergenic
920260862 1:204686706-204686728 GCTGTACCCTTGGAAAAGACAGG - Intergenic
924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924841793 1:247718610-247718632 GCTGAGTACTTTGGAAAAACTGG + Intergenic
1064380407 10:14837317-14837339 ACTGACTCCTTGGGAAAGAGAGG - Intronic
1068181377 10:53523167-53523189 TATGATTCCTAGGAAAAAACAGG + Intergenic
1068804204 10:61176331-61176353 GATGAATCCTTGAAAAAAAGTGG + Intergenic
1069828989 10:71271306-71271328 GCTGTCTCGTTGGAACACACAGG + Intronic
1070010040 10:72464438-72464460 GCTTTCTCCTTGCAAAAATCTGG - Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1077869288 11:6248274-6248296 GTTGAGTCTTTGGAAAGAACTGG + Intergenic
1078438558 11:11345344-11345366 GCTGACTCCTGGGAGATAAGTGG + Intronic
1078872592 11:15362921-15362943 GCTGACTGCCTAGAAAAAAAAGG + Intergenic
1079504656 11:21139910-21139932 GCTGAATCATAGGAAAAAAATGG - Intronic
1080668407 11:34356006-34356028 GGTGACAGCTTGGAAAAATCAGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082817020 11:57515625-57515647 GCTGTCTCCTCGGAAGAAGCGGG + Exonic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084646142 11:70459690-70459712 CCTGTCTCTTTAGAAAAAACAGG + Intergenic
1084653335 11:70501575-70501597 GGTGACTCCCCGGAACAAACAGG + Intronic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1086293890 11:85343236-85343258 GCTGTCTCCTGGGAAAAAATGGG - Intronic
1086412936 11:86560016-86560038 GCTTCCTCATTGGAAAAAATGGG + Intronic
1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG + Intronic
1091896435 12:4108991-4109013 GCTGCCTCCTTAGACAGAACGGG + Intergenic
1093289229 12:17301087-17301109 GCTGACTCTTAGGCAAAAGCTGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1097059679 12:56273346-56273368 GCTAAGTCCTTGGAGAAAAATGG - Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1099314258 12:81064942-81064964 ACAGACTACCTGGAAAAAACGGG + Intronic
1099627900 12:85099293-85099315 GCATAGTCCTTGGAAAATACAGG + Intronic
1100832863 12:98533818-98533840 GTTGCCTCCCTGGAAGAAACTGG - Exonic
1101294198 12:103403794-103403816 GTTGACTACTTGGAAGACACCGG - Intronic
1107017915 13:35722566-35722588 TCTGGCTTCTTGGAAAAGACAGG + Intergenic
1108309001 13:49166852-49166874 GCAGAGTCCTTGTAAAAAATTGG + Intronic
1109866587 13:68272651-68272673 GCTGAAGCCTTGGAGAACACGGG + Intergenic
1109916022 13:68985752-68985774 GCTGGCTAGTTGGAAAAAATAGG + Intergenic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1110559380 13:76894209-76894231 ACTGACTCCTAGGAAGAAATGGG - Intergenic
1111502311 13:89137843-89137865 GCTGATTATGTGGAAAAAACTGG - Intergenic
1115589824 14:34853333-34853355 GCTGACTACTTGGCAAAGATAGG - Intronic
1117582161 14:57162410-57162432 ACTGACCCCTTGGCAAACACAGG + Intergenic
1119103528 14:71902982-71903004 CCTGACTCATTGGATAAACCAGG + Intergenic
1119930588 14:78542570-78542592 ACAGACTACCTGGAAAAAACGGG - Intronic
1120159020 14:81125973-81125995 GCTGACTTCTTGACAAGAACAGG + Intronic
1120828883 14:88980579-88980601 GTTGCCTCCTTGGAAACAAAAGG + Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1123832230 15:24152112-24152134 GCTGACTCTTTGGGAACAAAAGG - Intergenic
1123838117 15:24217164-24217186 GCTGACTCTTTGGGAACAAAAGG + Intergenic
1127001365 15:54510979-54511001 TCTGGCTCCTTGGAAACAAGTGG + Intronic
1127627858 15:60797890-60797912 CCTAACTCCTGGGAAAAGACTGG - Intronic
1128650078 15:69404827-69404849 GCAGACTCCTAGGGAAAACCAGG + Exonic
1132761294 16:1509713-1509735 CCTGACTCCATGGAAGAAAGGGG - Intronic
1138230233 16:55331175-55331197 GCTGACACTTTTGATAAAACGGG - Intergenic
1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG + Intergenic
1144445632 17:15325268-15325290 GCTGACTTCTTTGTAAAAATTGG - Intronic
1144661715 17:17075060-17075082 GCTGCCACCTTGGAAAAGTCTGG - Intronic
1144807882 17:17979628-17979650 GCTGACACCTGGGAAAAAGCCGG + Intronic
1145121107 17:20260729-20260751 GCTGACTCCTTGAAATGAGCTGG + Intronic
1146538659 17:33675418-33675440 CATGATTCCTTGGAACAAACAGG - Intronic
1147531810 17:41286122-41286144 GGGGAATGCTTGGAAAAAACTGG - Intergenic
1148253808 17:46110334-46110356 GCTTACTCCATGCAAAACACTGG + Intronic
1149120687 17:53160218-53160240 GCTGACTCTTTGGACAAATCAGG + Intergenic
1149207987 17:54270617-54270639 GCTGACTTCTTGGGTAAAATTGG - Intergenic
1149677668 17:58480599-58480621 GCTTACACGTTGGAAAAATCTGG - Intronic
1151068563 17:71181121-71181143 CCTGCCTCCTTGAAAAAAAATGG - Intergenic
1152670236 17:81599464-81599486 GCTGACTCCTTGTTAGAAACAGG + Intronic
1153658143 18:7303555-7303577 GCTGACTGCTGGGAAGAATCTGG + Intergenic
1155495948 18:26441927-26441949 GCTGCCTCCTTGAAAAGCACTGG - Intergenic
1158177999 18:54679202-54679224 GCTGACCCCTTGGACAGAAAGGG - Intergenic
1158700150 18:59738063-59738085 GCTGACTCCCTAGAAAAGCCAGG + Intergenic
1161661120 19:5546922-5546944 GCTGGCTGCGTGGAAAGAACAGG + Intergenic
1164291582 19:23874114-23874136 GCTGAGTGCTTTCAAAAAACAGG + Intergenic
1165862627 19:38917267-38917289 GGTGACCCATTGTAAAAAACTGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166495748 19:43301914-43301936 ACTGACTCTTTGGAAAACACAGG + Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925463231 2:4083248-4083270 GCTGACTTCTGGGAAGAACCAGG - Intergenic
928595714 2:32857035-32857057 GCTGCCTAATTGGAAAAAGCTGG + Intergenic
930405439 2:50949704-50949726 TCTGACTTCTTGGAAAAACTAGG + Intronic
930917730 2:56714402-56714424 GCTGTCCCCTTAGGAAAAACTGG - Intergenic
932412065 2:71553423-71553445 GCTGACTCCTTGAAATGATCAGG - Intronic
932836855 2:75046067-75046089 TCTGACACCTGGGAAAAAAGGGG - Intergenic
933615230 2:84476892-84476914 GCTGAGTGCTTGGAAGAACCAGG - Intergenic
934114139 2:88767477-88767499 GCTAACTACTTGGATAAATCTGG + Intergenic
934862618 2:97776992-97777014 GCCAACTACTTGGAAAAATCTGG + Intronic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935446449 2:103161652-103161674 GCTGACTCCCTGGCTAAAAATGG + Intergenic
935875558 2:107503076-107503098 GCTGTCTATTTGGAAAATACAGG + Intergenic
940036551 2:149318197-149318219 GCTGAGTGCTTGGAAGAACCAGG + Intergenic
941460149 2:165761088-165761110 GCAGACTCCTTGGCATAAAAAGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
947307513 2:228763921-228763943 CCTGCCTCCTGGGAAAGAACAGG + Intergenic
947393256 2:229661805-229661827 AGTGACCCCTTTGAAAAAACTGG + Intronic
947953303 2:234166138-234166160 CATGACTCTTTGAAAAAAACTGG + Intergenic
1173167130 20:40693142-40693164 GAGGGCTCCTTGGAAAAGACAGG - Intergenic
1174955828 20:55097225-55097247 GCTGACTCTTTGGTATAAAAAGG + Intergenic
1176019744 20:62956576-62956598 GCTGACCCCTGGGAGAACACAGG - Intronic
1176983432 21:15408918-15408940 GCTCAGTTCTTGCAAAAAACTGG + Intergenic
1177919280 21:27130231-27130253 ACTGAATTCCTGGAAAAAACTGG - Intergenic
1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG + Exonic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950168495 3:10819512-10819534 GCTGTCTCCAGGAAAAAAACAGG - Exonic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
953906072 3:46868843-46868865 GCTCACTCTTTGGACTAAACAGG - Intronic
953923513 3:46968187-46968209 GCTGAGTCCTTAGGAAGAACGGG + Intronic
958746851 3:98146533-98146555 GCTGGCTCCCTGAACAAAACTGG + Intergenic
959162605 3:102739324-102739346 GCTGACTACTTGGAAATTACAGG + Intergenic
960688989 3:120323729-120323751 GATGACTGCTTGGCAAAGACAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961662310 3:128475903-128475925 GCTGCCTCCTTGTGAGAAACAGG + Intergenic
962426541 3:135273673-135273695 GCTGCCTCCTTGGTAAAACCGGG + Intergenic
964370673 3:155996987-155997009 ACTGGCTTCTTGGAAAAAAATGG + Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965829553 3:172769048-172769070 GCTGACTGCTTTGAAGGAACTGG - Exonic
967360621 3:188626577-188626599 GCTTTCTCCTTGGATAAAAATGG + Intronic
969691814 4:8708053-8708075 GCTGACACCTTTGCAAGAACTGG - Intergenic
970342662 4:15122608-15122630 GCTGACCTCTTTGAAAAAATTGG - Intergenic
970978726 4:22072286-22072308 GCTCACTCCCTGGAAATAATAGG + Intergenic
971582658 4:28362507-28362529 CCTGACTCCTTTGAAGAAGCTGG + Exonic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
974354253 4:60791574-60791596 ACTGACTAGTGGGAAAAAACAGG - Intergenic
975477359 4:74839102-74839124 ACTGATTCCTAGGAGAAAACTGG - Intergenic
979203165 4:118003558-118003580 GCTTACTCCTTGGAGATACCAGG - Intergenic
981633619 4:146849882-146849904 GCTGACTTTTGGGAAAAGACTGG - Intronic
981715891 4:147751710-147751732 GCTAACTCCTGTGAAAACACTGG - Intronic
983085365 4:163437077-163437099 ACTGACTCCCTGGTGAAAACAGG + Intergenic
983814443 4:172105976-172105998 GCTGATACTTTGGAAAAAATTGG + Intronic
985063279 4:186098669-186098691 GGTGACACCTTGGAAACACCAGG + Intergenic
987051295 5:14148739-14148761 GCTGAGTACTTGGAAGAAATGGG - Intronic
991321773 5:65382101-65382123 GTTAACTCTTTGGAAAAAGCTGG + Intronic
992458623 5:76939848-76939870 TCTGACTCCTTTAAAAAATCAGG + Intergenic
995280611 5:110331387-110331409 GCTGACTCCTTGATTCAAACTGG + Intronic
995808368 5:116079246-116079268 GCTGAAGCCTTGGAAACAAGTGG - Intergenic
996084545 5:119291086-119291108 GCTGACTACCTGGATAATACTGG - Intronic
996686684 5:126290169-126290191 GCTGTCTTCTGGGAAGAAACTGG + Intergenic
996824584 5:127667447-127667469 ACTGACTCCTGGGAAAGAAGGGG - Intergenic
997531357 5:134583324-134583346 GCTGATCCCTTGGAAAACTCAGG - Intergenic
1000044101 5:157507405-157507427 GCTGATTCCTTGGAAGGAAATGG + Intronic
1000223129 5:159233446-159233468 GCGGAAACCTTGGAAAAATCTGG + Intergenic
1003035764 6:2639156-2639178 GGCGACACCCTGGAAAAAACAGG - Intergenic
1007270110 6:40629836-40629858 GCTGACTGCTTGGAAAGGAAGGG - Intergenic
1009450680 6:63796750-63796772 TCTCACTCTTTTGAAAAAACTGG + Intronic
1009462580 6:63932387-63932409 TCTGACTCCTGAGAAAAAAGTGG + Intronic
1012527272 6:100193031-100193053 GCTGAGGCCTGGGAAAAAGCAGG + Intergenic
1013533865 6:111045586-111045608 GCTGATTTCTTGGCAAAAATTGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016002087 6:139051902-139051924 CATGACTCCTTGGAAAAAGAGGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1020179264 7:5908736-5908758 TCTGTCTCCTTTTAAAAAACCGG + Intronic
1020303670 7:6816119-6816141 TCTGTCTCCTTTTAAAAAACCGG - Intronic
1024505126 7:50156368-50156390 GATGACTTCTTAGAAATAACAGG - Intronic
1024735915 7:52303618-52303640 GGTGACTCTTTGGAAAAGAAAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026672030 7:72399113-72399135 GCTGACACCTTAGCAAAGACAGG + Intronic
1026672313 7:72401064-72401086 GTTGACACCTTAGCAAAAACGGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030653738 7:112143656-112143678 TCTGACTGGTTGGAAAGAACAGG - Intronic
1031117597 7:117684999-117685021 GTTGAGTCCTTGGAGAAAGCTGG + Intronic
1031203171 7:118717838-118717860 GCTGATGCCTTGGAAAAATCTGG + Intergenic
1033533093 7:142285853-142285875 GGTGAAACCTTGGAAAACACAGG + Intergenic
1034372787 7:150615032-150615054 GCTGAGCACTTGGAAGAAACAGG - Intergenic
1038191585 8:25326003-25326025 CCTGACTGCTTGGAAAAAAATGG - Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1040029183 8:42808980-42809002 GGTGAATCCTTGGACAAATCAGG - Intergenic
1043069372 8:75619732-75619754 GCTTACTCCTGTGAAACAACTGG - Intergenic
1043100464 8:76038837-76038859 AATGACTCCTTGGAAAAAGAAGG - Intergenic
1044609103 8:94074488-94074510 GCAAACTCCATGGAAAACACTGG - Intergenic
1044667374 8:94643425-94643447 GCTGGCTTCTGGGAAAAAAATGG + Intronic
1046086459 8:109443018-109443040 AATGACTCCTTGGAGAAAAATGG - Exonic
1047432534 8:124805327-124805349 GCCGGCTTCTGGGAAAAAACTGG - Intergenic
1047871930 8:129093354-129093376 ACTGTCTCCTTGAAAAAAACAGG + Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1051018028 9:12505250-12505272 GCTGAATACTTGGAAATAAGAGG - Intergenic
1051859785 9:21611408-21611430 GCTGAGTCCTTTGAAAGAACAGG - Intergenic
1052485146 9:29087766-29087788 CCTCATTCCTTGGAAAAAAAAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060681576 9:125569638-125569660 ACAGCCTCCTTGGGAAAAACAGG + Intronic
1061566074 9:131441237-131441259 TCTGACTCCCTCAAAAAAACTGG - Intronic
1061640368 9:131949576-131949598 GAGGATTCCTTGGAAAAAGCAGG + Intronic
1062648086 9:137560339-137560361 GCTGAGACTTAGGAAAAAACAGG + Intronic
1186394766 X:9196440-9196462 CCTGGCTCCATGGAAAAACCTGG + Intergenic
1187879761 X:23835886-23835908 GCTCAATCCTTGTAGAAAACAGG + Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1195927548 X:110040900-110040922 ACTGACTCTTTGGATAAAACAGG + Intronic
1196358090 X:114818682-114818704 GCTGCCTCTTTGGTAAAAACAGG + Intronic
1197894930 X:131302459-131302481 GCTGAGGCCTTGTAAAAAAATGG + Intronic
1198421599 X:136474318-136474340 ACTGTCTCCTTGGAAAAAGAGGG + Intergenic