ID: 1088925916

View in Genome Browser
Species Human (GRCh38)
Location 11:114302741-114302763
Sequence ATTTCAACACAGAAATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1402
Summary {0: 1, 1: 2, 2: 31, 3: 229, 4: 1139}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088925916_1088925930 30 Left 1088925916 11:114302741-114302763 CCTCCCAATTTCTGTGTTGAAAT 0: 1
1: 2
2: 31
3: 229
4: 1139
Right 1088925930 11:114302794-114302816 CGGGGCTTTGAAAGGTCATTAGG 0: 1
1: 0
2: 1
3: 44
4: 535
1088925916_1088925928 12 Left 1088925916 11:114302741-114302763 CCTCCCAATTTCTGTGTTGAAAT 0: 1
1: 2
2: 31
3: 229
4: 1139
Right 1088925928 11:114302776-114302798 ATGATGGTATTAAGAGGTCGGGG 0: 1
1: 1
2: 27
3: 81
4: 220
1088925916_1088925923 6 Left 1088925916 11:114302741-114302763 CCTCCCAATTTCTGTGTTGAAAT 0: 1
1: 2
2: 31
3: 229
4: 1139
Right 1088925923 11:114302770-114302792 CCCCTTATGATGGTATTAAGAGG 0: 1
1: 0
2: 19
3: 178
4: 813
1088925916_1088925919 -4 Left 1088925916 11:114302741-114302763 CCTCCCAATTTCTGTGTTGAAAT 0: 1
1: 2
2: 31
3: 229
4: 1139
Right 1088925919 11:114302760-114302782 AAATCCTAACCCCCTTATGATGG 0: 1
1: 0
2: 5
3: 28
4: 163
1088925916_1088925929 22 Left 1088925916 11:114302741-114302763 CCTCCCAATTTCTGTGTTGAAAT 0: 1
1: 2
2: 31
3: 229
4: 1139
Right 1088925929 11:114302786-114302808 TAAGAGGTCGGGGCTTTGAAAGG 0: 1
1: 0
2: 4
3: 71
4: 604
1088925916_1088925926 10 Left 1088925916 11:114302741-114302763 CCTCCCAATTTCTGTGTTGAAAT 0: 1
1: 2
2: 31
3: 229
4: 1139
Right 1088925926 11:114302774-114302796 TTATGATGGTATTAAGAGGTCGG 0: 1
1: 49
2: 216
3: 889
4: 2313
1088925916_1088925927 11 Left 1088925916 11:114302741-114302763 CCTCCCAATTTCTGTGTTGAAAT 0: 1
1: 2
2: 31
3: 229
4: 1139
Right 1088925927 11:114302775-114302797 TATGATGGTATTAAGAGGTCGGG 0: 1
1: 7
2: 125
3: 707
4: 2008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088925916 Original CRISPR ATTTCAACACAGAAATTGGG AGG (reversed) Intronic
900694265 1:4000329-4000351 ATTTCAACATATGAATTTGGGGG + Intergenic
900752905 1:4410486-4410508 ATTTCAACATAAGATTTGGGTGG - Intergenic
900814553 1:4833405-4833427 ATTTCAACACAGAAACTGTGGGG + Intergenic
901219078 1:7572745-7572767 ATTTCAACATAGGAATTTGGGGG + Intronic
901335382 1:8444579-8444601 ATTTCAACATGAAATTTGGGAGG - Intronic
901778065 1:11574284-11574306 ACTTCAACATATAAATTTGGGGG - Intergenic
901826706 1:11866654-11866676 ATTTCAACATACGAATTTGGGGG + Intergenic
901863810 1:12090853-12090875 ACTTCAACATAGGAATTGGTTGG - Intronic
902083274 1:13836102-13836124 ATTTCAACAGATAAATTTGGAGG + Intergenic
902189575 1:14752721-14752743 GTTTCAACATAGGAATTTGGTGG + Intronic
902296056 1:15467706-15467728 TTATCCACACAGAAATTTGGGGG - Intronic
902329871 1:15726007-15726029 ATTTCAACACAGGAATCTGGAGG + Intronic
902446816 1:16471900-16471922 ATTTCAACATATGAATTTGGGGG + Intergenic
902686938 1:18083884-18083906 ACTTCAACACATAAATGCGGAGG + Intergenic
903001758 1:20271210-20271232 ATTTCAACATATGAATTTGGGGG - Intergenic
903425556 1:23251629-23251651 ATTTCAACATAGGAATCGAGGGG + Intergenic
904404491 1:30277078-30277100 ACTTCAACACAGGATTTTGGGGG - Intergenic
905540084 1:38753772-38753794 ATTTCAACATAAAATTTGGGAGG - Intergenic
905698105 1:39990812-39990834 ATTTCAACATAGAAATTTTGAGG + Intergenic
906260460 1:44384320-44384342 ATTTCAACATATGAATTTGGAGG + Intergenic
906771369 1:48487896-48487918 ACTTCAACATGGAAATTTGGGGG - Intergenic
906817415 1:48893268-48893290 AGTTCAACACATAAATTGAGGGG - Intronic
907088777 1:51704805-51704827 ATTTCAACATAGGAATTTTGGGG + Intronic
907715491 1:56922497-56922519 ATTTCAACATAGGAATTTGGGGG - Intergenic
907976341 1:59434823-59434845 GTTTCAACACAGGAATTTTGAGG + Intronic
908038248 1:60079370-60079392 ACTCCAACAAATAAATTGGGAGG + Intergenic
908038414 1:60081327-60081349 ATTTCAACATATAAATTTGGGGG - Intergenic
908078024 1:60542567-60542589 AGCTCAACACAAAAATTTGGGGG + Intergenic
908204629 1:61833200-61833222 ATATCAACACAGAGATAGGCTGG - Intronic
908570928 1:65409201-65409223 ATTTCAACATAGCAATTTTGGGG + Intronic
908650045 1:66322722-66322744 GTTTCAACACAGGAATTTTGGGG + Intronic
908783705 1:67714716-67714738 ATTTCAACATATAAATTTTGGGG - Intronic
908890662 1:68843973-68843995 ACTTCAACATATGAATTGGGGGG - Intergenic
908905708 1:69006340-69006362 TTTTCAACATAGCAATTTGGGGG + Intergenic
909136165 1:71803058-71803080 ATTTCAACATATAAATTTGGGGG - Intronic
909380942 1:74997688-74997710 ATTTTAACAAAAAAATTTGGGGG - Intergenic
909545784 1:76844910-76844932 ATTTCAACATATGAATTTGGGGG + Intergenic
909549535 1:76882431-76882453 ATTACATCTCAGAATTTGGGGGG - Intronic
909711560 1:78655892-78655914 ACTTCAACATATAAATTTGGGGG - Intronic
909735813 1:78960655-78960677 ATTTCAACATACAAATTTGGGGG - Intronic
909844885 1:80380537-80380559 AGTTCAACATATGAATTGGGTGG + Intergenic
909912456 1:81277755-81277777 ATTTCAACACATGAATCTGGAGG + Intergenic
910084264 1:83380445-83380467 ATTTCAACACATGAACTTGGAGG + Intergenic
910676013 1:89817799-89817821 ATTTCAACATATAAAATGGAGGG - Intronic
910783236 1:90965504-90965526 ATTTCAACATAAGAATTTGGAGG + Intronic
910961210 1:92765644-92765666 TTTTCAACACAGAATTTTGCTGG + Intronic
910962342 1:92776235-92776257 ATTTTAACACAGAAAAAGGATGG + Intronic
911643822 1:100317709-100317731 GTTCCAACACAGGAATTTGGGGG - Intergenic
911812825 1:102305541-102305563 ATTTCAACATATAAATTTTGAGG + Intergenic
911866936 1:103039360-103039382 ATTTCAACATACAAATTCGAGGG - Intronic
911905429 1:103562135-103562157 ATTTCAAGACAAAAAGTTGGAGG - Intronic
911998233 1:104795522-104795544 ATTTCAACATATAAATTTGAGGG - Intergenic
912110877 1:106341247-106341269 ATTTCAACATATAAATTTTGGGG - Intergenic
912547554 1:110461785-110461807 ATTTCAACACATAAATTCAGGGG + Intergenic
912585727 1:110763079-110763101 ATTTCAACAAATAAATTTTGAGG + Intergenic
912724529 1:112046874-112046896 TTTACACCACAGAAATTGGCAGG + Intergenic
912959437 1:114182059-114182081 ATTTCAACACATGAATTTTGGGG + Intergenic
913067707 1:115271778-115271800 ATTTCAACATATAAATTTTGAGG + Intergenic
913082283 1:115399768-115399790 ATTTCAACACAGTAATTTTGGGG - Intergenic
913085143 1:115429874-115429896 ATATCAACATATAATTTGGGAGG + Intergenic
913247990 1:116887325-116887347 ATTTCAACATGGGATTTGGGTGG - Intergenic
913503360 1:119492334-119492356 GTTTCAACACATGAATTTGGAGG + Intergenic
913551593 1:119922017-119922039 ACCTCAACACAGAAGCTGGGCGG + Intronic
913590498 1:120320159-120320181 ATTTCAACATATAAACTGGTGGG - Intergenic
913616677 1:120566897-120566919 ATTTCAACATATGAATTTGGAGG - Intergenic
913617686 1:120578204-120578226 ATTTCAACATATAAACTGGTGGG + Intergenic
913647564 1:120873715-120873737 ATTTCAATATACAAATTTGGGGG - Intergenic
914079074 1:144389145-144389167 ATTTCAATATACAAATTTGGGGG + Intergenic
914100105 1:144577357-144577379 ATTTCAATATACAAATTTGGGGG - Intergenic
914173978 1:145257692-145257714 ATTTCAATATACAAATTTGGGGG + Intergenic
914298884 1:146360325-146360347 ATTTCAATATACAAATTTGGGGG + Intergenic
914395235 1:147260652-147260674 TTTTCAACAGGTAAATTGGGGGG - Intronic
914528639 1:148498877-148498899 ATTTCAATATACAAATTTGGGGG + Intergenic
914572586 1:148932768-148932790 ATTTCAACATATAAACTGGTGGG - Intronic
914573598 1:148944013-148944035 ATTTCAACATATGAATTTGGAGG + Intronic
914600254 1:149197494-149197516 ATTTCAACATATAAACTGGTGGG + Intergenic
914637753 1:149568230-149568252 ATTTCAATATACAAATTTGGGGG - Intergenic
915219223 1:154360719-154360741 ATTTCAACATATGAATTGGGGGG - Intergenic
915715965 1:157945498-157945520 ATTTCAACATATAAATTCAGGGG - Intergenic
915830729 1:159127425-159127447 ATTTCAACATAGGAATTTTGTGG - Intronic
916002610 1:160631485-160631507 GCTTCAACATAGAAATTTGGGGG - Intronic
916204377 1:162301186-162301208 ATTTCAACATACAAATTTTGGGG - Intronic
916476435 1:165173818-165173840 ATTGGAAAACAGAAATAGGGAGG + Intergenic
916993344 1:170268396-170268418 ATTTCAACATAGAAATTTTGAGG - Intergenic
917100777 1:171442991-171443013 ATGTTAAAACAGAAATGGGGGGG - Intergenic
917161535 1:172062157-172062179 ACTTCACAACAGAAAGTGGGAGG - Intronic
917417667 1:174827440-174827462 ATTTCAACATATTAATTGGGGGG + Intronic
917625203 1:176839083-176839105 ATTTGAACACATAAACTGGAAGG + Intronic
917744287 1:177992602-177992624 ATTTCAACATATTAATTGTGGGG + Intergenic
918016070 1:180633124-180633146 GTGTTAGCACAGAAATTGGGAGG - Intronic
918623729 1:186634300-186634322 ACTTCAACATATAAATTTGGTGG + Intergenic
918748796 1:188243588-188243610 ATTTAAAAACAAAATTTGGGCGG + Intergenic
918869446 1:189949887-189949909 ATTTCCACATATAAATTTGGGGG + Intergenic
918905913 1:190493375-190493397 ACTTCAACACATGAATTTGGAGG + Intergenic
918981129 1:191560785-191560807 ATTTCAACACGATATTTGGGTGG - Intergenic
919019698 1:192088366-192088388 ATTTCAACACACAAATTTTGAGG - Intergenic
919138495 1:193540629-193540651 GTTTCAACACATGAATTTGGGGG - Intergenic
919658306 1:200218528-200218550 ATTTCAAAAAAGAAATGGGAGGG + Intergenic
919687632 1:200499157-200499179 ATTTCAACGTATAAATTTGGGGG - Intergenic
920831185 1:209467152-209467174 ATTTCAACACATGAATTTGGTGG - Intergenic
921126285 1:212180899-212180921 ATTTCAACATAGGAATTTTGCGG - Intergenic
921354534 1:214273903-214273925 ATTTCAACATATGAATTTGGTGG + Intergenic
921391697 1:214621837-214621859 ATTTTAACAAAGAAACTTGGTGG - Intronic
921410366 1:214829861-214829883 ATTTCAACATATAAATTCTGGGG + Intergenic
921579782 1:216882670-216882692 ATATCAATGCAGAAAATGGGTGG + Intronic
921753453 1:218824793-218824815 GTTTCAACATATGAATTGGGGGG - Intergenic
921803195 1:219425273-219425295 ATTTCAACATATGAATTTGGGGG + Intergenic
921941178 1:220841580-220841602 ATTTCAACATACAGATTTGGGGG - Intergenic
922070409 1:222187209-222187231 AATTCAAGACAAAATTTGGGTGG - Intergenic
922177121 1:223205322-223205344 ATCTCAACATATAAATTGGGTGG + Intergenic
922367754 1:224881843-224881865 AATTCAACACAAGATTTGGGTGG + Intergenic
922589655 1:226765183-226765205 AATTCAACACAAGATTTGGGTGG - Intergenic
922743451 1:228029745-228029767 ATTTCAATGTAGGAATTGGGGGG - Intronic
922806381 1:228392095-228392117 ATTTCAACATATGAATTTGGGGG + Intergenic
922818362 1:228467373-228467395 TTTTCAACCTAGAAATTTGGAGG - Intergenic
923378100 1:233386904-233386926 ATTTCAACATAGGAATTTTGAGG - Intergenic
923394936 1:233552640-233552662 ATTTCAACACAAAATTTTTGGGG - Intergenic
923440760 1:234017941-234017963 ATTTCACCACTCAATTTGGGGGG + Intronic
923623710 1:235597403-235597425 ATTTCAATATAGGAATTTGGGGG - Intronic
923929144 1:238673882-238673904 GCTTCAACACAGGAATTTGGGGG - Intergenic
924240268 1:242033345-242033367 GTTTCAACATAGGAATTTGGGGG + Intergenic
924260363 1:242223292-242223314 ATTTCAACACATAAATTTGGGGG + Intronic
1062894951 10:1096343-1096365 CCTTCAACACTGAACTTGGGGGG - Intronic
1063066521 10:2615348-2615370 ATGTCAACATAGAAATTTAGAGG + Intergenic
1063559159 10:7110362-7110384 AGTTCAACACAGCAATTTGGAGG + Intergenic
1063723392 10:8609296-8609318 GTTTCAGCACATAAATTTGGTGG + Intergenic
1063787672 10:9403489-9403511 ATTTCAACATATAAATTTTGAGG - Intergenic
1063927372 10:10993762-10993784 ACTTCAACACACAAATTTTGGGG - Intergenic
1063997471 10:11633897-11633919 ATTTGAACTCAGGAATTGTGAGG + Intergenic
1064096610 10:12428721-12428743 ATTTCAACAGAGAAATTTCGTGG - Intronic
1064162007 10:12954765-12954787 ATTTCAACATGGAATTTGGAGGG + Intronic
1064184318 10:13147431-13147453 ATTTCAACATGGAATTTGGAGGG + Intergenic
1064390618 10:14938960-14938982 ATTTCAACATAGGAATTTTGGGG - Intronic
1064524772 10:16243259-16243281 AGTTCAACATATAAATTTGGGGG - Intergenic
1064819947 10:19317413-19317435 ATTTCAACATACAAATTTTGGGG + Intronic
1064855584 10:19764377-19764399 TTTTCAACAAAGAAATTGTGAGG - Intronic
1064912423 10:20416983-20417005 ATTTCAACATATGAATGGGGGGG - Intergenic
1065209446 10:23388779-23388801 ATTTCAACATTTAAATTTGGTGG + Intergenic
1065524955 10:26610859-26610881 GTTTCAACACAGGAATTTTGGGG - Intergenic
1065663092 10:28026463-28026485 ATTTCAACATGAAAATTGGGAGG - Intergenic
1065667232 10:28075245-28075267 ATTTCAACATGAAATTTGGGTGG + Intronic
1065668353 10:28086998-28087020 ATTTCAACACGCAATTTGGGGGG - Intronic
1065993791 10:31037426-31037448 ACTTCAACACACAAACTGGGGGG - Intergenic
1066373710 10:34838659-34838681 ATTTAAACAGATGAATTGGGTGG + Intergenic
1067036545 10:42924818-42924840 ACTTCAACGCAGGAATTCGGGGG + Intergenic
1067710925 10:48650691-48650713 ATTTCATCATAGAAATCTGGTGG + Intronic
1068218880 10:54017622-54017644 ATTAATAGACAGAAATTGGGTGG + Intronic
1068654641 10:59562173-59562195 ATTTCAACATGAAATTTGGGTGG + Intergenic
1068748908 10:60568738-60568760 ATTTTAACATATAAATTTGGGGG - Intronic
1068761980 10:60722622-60722644 ATTTCAACATGGAATTTGGAGGG - Intronic
1068945880 10:62728294-62728316 ATTTCAACATATAAATTTGGGGG + Intergenic
1069188128 10:65452675-65452697 ATTTCAACACATAAATTTTTAGG - Intergenic
1069338540 10:67382997-67383019 ATTTCAACACAGGATTTTGAAGG + Intronic
1070366452 10:75741810-75741832 AGTTCAACACAGAAATTTGGGGG - Intronic
1071089516 10:81902350-81902372 ATTTTAACACAGAAATTTAGGGG - Intronic
1071223725 10:83500837-83500859 ATTTCAACATATAAATTTGGGGG - Intergenic
1071379570 10:85044653-85044675 ATTTAAACATATAAATTAGGGGG + Intergenic
1071884108 10:89930857-89930879 ATTTCAACACATAAATTTACTGG - Intergenic
1072443089 10:95474531-95474553 ATTCAAACACTGAAATTTGGAGG + Intronic
1072708694 10:97701113-97701135 ATTTCAACATAAGAATTTGGAGG + Intergenic
1073478348 10:103769072-103769094 ATTTCAACATAAGACTTGGGGGG + Intronic
1073529888 10:104221335-104221357 ATTTCAACATATAAATTTGGTGG - Intronic
1073538960 10:104302623-104302645 ATTTCAACACGAAATTTGGTGGG - Intronic
1073672971 10:105613028-105613050 ATTTCAACATATGAATTTGGGGG + Intergenic
1073944900 10:108739329-108739351 ATTTCAACACGAGATTTGGGTGG + Intergenic
1073973263 10:109069394-109069416 ATTTCAACATATGAATTTGGAGG + Intergenic
1074258977 10:111832918-111832940 ATTTAAACTCAGCAATTGTGAGG - Intergenic
1074606292 10:114971254-114971276 ATTTCAGCATATAAATTTGGAGG + Intronic
1074868616 10:117560012-117560034 ATTTCAACACGTAAATTTGAGGG - Intergenic
1075064339 10:119279325-119279347 ACTTCAACACAGGAATTTGGGGG + Intronic
1075323522 10:121511454-121511476 TTTTCCACACATCAATTGGGTGG - Intronic
1075395898 10:122126880-122126902 ATTTCAACACAGGAATTTCGGGG - Intronic
1075406656 10:122199997-122200019 ATTTCAACATAGGAATTTCGGGG + Intronic
1075427574 10:122353775-122353797 ATTTCAACATGGAATTTGGAGGG - Intergenic
1075957653 10:126537806-126537828 ATTTCAACAGAGGAATTTTGAGG - Intronic
1076057899 10:127390390-127390412 ATTTCAACATAGGAATTTTGGGG - Intronic
1076071574 10:127494181-127494203 ATTTCAACATAGGAATTTGGGGG + Intergenic
1076286065 10:129297533-129297555 ATTTAAACAGAGAAACAGGGAGG - Intergenic
1076309860 10:129497676-129497698 GTTTCAACACAGGAATTTGGAGG - Intronic
1077146361 11:1048029-1048051 ATTTCAACACAGGAACCGGAGGG - Intergenic
1077280310 11:1741781-1741803 ATTTCCATACAGGAATTTGGGGG - Intronic
1077982772 11:7317631-7317653 GTTTCAATATATAAATTGGGAGG + Intronic
1078405084 11:11063488-11063510 ATTTCAACAAAGGATTTGGAGGG + Intergenic
1078424092 11:11235299-11235321 ATTTCGACACATGAATTTGGTGG - Intergenic
1079175535 11:18136951-18136973 ATGTCAGCACAGAACTTGTGTGG + Intronic
1079179101 11:18173005-18173027 ATGTCAGCACAGAACTTGTGTGG + Exonic
1079790055 11:24725726-24725748 ATTTCAACACATAAATTTGGAGG - Intronic
1079816108 11:25060465-25060487 ATTTCAACATATAAATTTTGCGG + Intronic
1080081832 11:28229469-28229491 GTTTCAACACAGGAATTTAGGGG - Intronic
1080104542 11:28498166-28498188 ATTTCAACACATGAATTCCGGGG + Intergenic
1080193993 11:29586452-29586474 ATTTCAACATATAAATTGGAGGG - Intergenic
1080621900 11:33993641-33993663 ACTTCAACATAGGAATTGGGAGG + Intergenic
1080964358 11:37196664-37196686 ATTTCAACATAAAGTTTGGGAGG + Intergenic
1081034735 11:38128747-38128769 ATATCAACACAAAATTTGGAGGG + Intergenic
1081115607 11:39195064-39195086 AGTCAAACACAGAAATAGGGGGG - Intergenic
1081183041 11:40007418-40007440 ATTTCAACATATAAATTGGTGGG + Intergenic
1081337063 11:41879911-41879933 GTTTTAACATATAAATTGGGGGG - Intergenic
1081792571 11:45798781-45798803 AGTTCAACACAGGATTTGGGTGG + Intergenic
1082128023 11:48455246-48455268 ATTTCAACATAAGATTTGGGTGG + Intergenic
1082248733 11:49956202-49956224 ATTGCACCACAGAAAATGGGAGG + Intergenic
1082249395 11:49962171-49962193 ATTTCAACATAAGATTTGGGTGG - Intergenic
1082264548 11:50105131-50105153 ATCTCAAAAAAGAAATCGGGTGG + Intergenic
1082562218 11:54632169-54632191 ATTGCACCACAGAAAATAGGAGG - Intergenic
1083138554 11:60702839-60702861 ATTTCAACACATGAATTTGGAGG + Intronic
1083235530 11:61348508-61348530 CTTTCAACACAGGAATTTGGGGG - Exonic
1084439559 11:69164799-69164821 CTTTCAACACTAAAATGGGGAGG + Intergenic
1084498555 11:69520549-69520571 AATTCAACACAAGATTTGGGTGG + Intergenic
1084628312 11:70326991-70327013 ATTTCACAACAAAAATGGGGAGG - Intronic
1084654938 11:70509659-70509681 GTTTCAACACATAGACTGGGGGG - Intronic
1084709793 11:70836821-70836843 GTTTCAACACATGAATTTGGAGG - Intronic
1084720986 11:70905505-70905527 ATTTCAACACATGAATTCGGAGG - Intronic
1084770916 11:71342423-71342445 ATATCAACATAGGAATTGTGGGG - Intergenic
1084917936 11:72444675-72444697 TTTCCAACATAAAAATTGGGTGG - Intergenic
1085427900 11:76421383-76421405 ATTTCATCCCATAAATTAGGAGG - Intergenic
1085532540 11:77200561-77200583 GTTTCAACAGAGAGATTTGGAGG + Intronic
1085600456 11:77851515-77851537 ATTTCAACAAAAGATTTGGGTGG - Intronic
1085904007 11:80738151-80738173 ATTTCAACATGGGATTTGGGCGG - Intergenic
1086187924 11:84041777-84041799 ATTTCAAGATGGAATTTGGGTGG - Intronic
1086839932 11:91672623-91672645 ATTCCAACATAGAAATTTTGGGG - Intergenic
1086843035 11:91712029-91712051 ATTTTAACATACAAATTTGGGGG + Intergenic
1086843648 11:91720535-91720557 ATTTCAACATAGGATTTTGGAGG + Intergenic
1086998806 11:93391818-93391840 ATTTCATCAAATAAATTGGAAGG + Intronic
1087229801 11:95647701-95647723 ACTCCAACACAGAAATTATGTGG + Intergenic
1087739243 11:101868848-101868870 ATTTCAACATATGAATTTGGGGG + Intronic
1087840664 11:102917781-102917803 ATTTCAACAAAGAAATTTTGGGG - Intergenic
1088164271 11:106913589-106913611 ATTTCAACATAGGATTTGGAAGG + Intronic
1088386161 11:109258722-109258744 ATTTCAACACGAGAAGTGGGCGG + Intergenic
1088446355 11:109933155-109933177 GTTTCAACATATAAATTTGGAGG + Intergenic
1088710335 11:112502267-112502289 ACTTCAACATATAAATTTGGGGG + Intergenic
1088713407 11:112528044-112528066 ATCTCAACACAGGAATTTTGGGG - Intergenic
1088824015 11:113478464-113478486 ATTTCAACATATGAATTGGGGGG + Intergenic
1088925916 11:114302741-114302763 ATTTCAACACAGAAATTGGGAGG - Intronic
1089153920 11:116386031-116386053 CTTTCATCAGAGAAATGGGGAGG + Intergenic
1089421363 11:118333212-118333234 AATTCAACACAGGAATTTCGGGG + Intergenic
1089469171 11:118707127-118707149 ATTTCAACACAGGAATTGCGAGG - Intergenic
1089827047 11:121287460-121287482 ATTTCAACATATGAATTTGGGGG + Intergenic
1089958426 11:122594513-122594535 ATTTCAACACAGGAATTTGCAGG - Intergenic
1089985198 11:122805851-122805873 TTTCCAACACAGAAATTGAGTGG + Intronic
1090064018 11:123488233-123488255 ATTTCAACATATACATTTGGGGG + Intergenic
1090088431 11:123672101-123672123 ATGTGCAAACAGAAATTGGGGGG - Intergenic
1090884864 11:130866941-130866963 CTTTCCTCACAGAGATTGGGTGG - Intergenic
1090949179 11:131457725-131457747 ATTTTAACACATAAATTTGGGGG - Intronic
1091155179 11:133365559-133365581 AGTTCAACACGGGAATAGGGAGG + Intronic
1091293361 11:134454928-134454950 AATGCAACACAGAGAATGGGTGG - Intergenic
1091637191 12:2206010-2206032 ATTTCAGCATAGGAATTTGGGGG + Intronic
1091667547 12:2430235-2430257 ATTTCAACATAGGAATTTGGGGG + Intronic
1091739565 12:2951033-2951055 ACCTCAACACACAAATTTGGAGG + Intergenic
1091862538 12:3799103-3799125 ATTTCAACATAGGAATTTGGGGG - Intronic
1092043266 12:5404440-5404462 ACTTCAACATATAAATTTGGGGG + Intergenic
1092068896 12:5616459-5616481 ATTTCAACATAGGAATTTTGGGG + Intronic
1092523060 12:9292900-9292922 ATTTCAACACAGGAATTTGGAGG + Intergenic
1092544231 12:9438997-9439019 ATTTCAACACAGGAATTTGGAGG - Intergenic
1092976142 12:13746650-13746672 ATTTCAACATGGGATTTGGGGGG - Intronic
1093412304 12:18881139-18881161 ATTTCAACATATAAATTTTGGGG + Intergenic
1093972577 12:25388768-25388790 ATTTCAACATACCAATTTGGGGG - Intergenic
1093972585 12:25388805-25388827 ACTTCAACAGACAAATTTGGGGG - Intergenic
1094025286 12:25955405-25955427 ATTTCAACACGAAATTTGGAGGG + Intergenic
1094443440 12:30504466-30504488 ATTTAAACACATGAATTTGGGGG + Intergenic
1094508715 12:31083071-31083093 ATTTCAACACAGGAATTTGGAGG + Intronic
1095159394 12:38899182-38899204 ATTTCAACACATGAATTTTGGGG - Intronic
1095383964 12:41628495-41628517 ATTTCAGCACATGAATTTGGGGG - Intergenic
1095924907 12:47568699-47568721 ATTTCAACATACAAATTTGGGGG + Intergenic
1095929268 12:47609333-47609355 GTTTCAACATATAAATTTGGGGG + Intergenic
1096388111 12:51208567-51208589 ATTTCAACACATGAATTTGCGGG - Intronic
1097095310 12:56543025-56543047 TTTTCAAAAAAGAAATTTGGAGG - Intronic
1097356733 12:58610683-58610705 ATTTCAACACATAAATGTTGGGG - Intronic
1097594131 12:61606780-61606802 ATTTCAACACAAGAATTGGAGGG - Intergenic
1097703121 12:62840389-62840411 ATTTCAACATATGCATTGGGAGG + Intronic
1098094705 12:66942733-66942755 ATTTCAACATATAAATTTTGAGG - Intergenic
1098269413 12:68755238-68755260 ATTTCAACATAGGAATTTTGGGG + Intronic
1098449593 12:70604641-70604663 GTTTCAACATATAAATTTGGTGG - Intronic
1098800820 12:74955694-74955716 ATTTCAACATGAAATTTGGGTGG - Intergenic
1098854133 12:75633215-75633237 ATTTAAACATAAAAATTTGGGGG - Intergenic
1099148804 12:79082113-79082135 AATTCAACACAGATTTTGGAAGG + Intronic
1099166144 12:79309349-79309371 ATTTCAAAATAGAACATGGGAGG - Intronic
1099224401 12:79952133-79952155 ATTTCAACACAGGAATTTTGGGG - Intergenic
1099482327 12:83183393-83183415 ATTTCAACACATAAAGTTAGAGG + Intergenic
1099753854 12:86814638-86814660 ATTTCAACACATGAATTTCGGGG - Intronic
1099783554 12:87231659-87231681 GCTTCAACATATAAATTGGGGGG + Intergenic
1100149116 12:91714011-91714033 ATTTCAGCACATGAATTTGGGGG + Intergenic
1100593665 12:96053292-96053314 ATTTCAACATATAAATTTTGGGG - Intergenic
1100642605 12:96496677-96496699 ATTTCAACATATGAATTGGGGGG + Intronic
1100693631 12:97066280-97066302 GTGTCAACACAGAAATTCTGGGG - Intergenic
1100765733 12:97863465-97863487 ATTTCAACACATGAATTTGGGGG - Intergenic
1100923978 12:99523030-99523052 TTTTCAAATCAGAAATTAGGTGG + Intronic
1100944681 12:99768422-99768444 ATTTCAACATATAAACTTGGCGG - Intronic
1101071007 12:101076140-101076162 ATTTCAACATATGAATTTGGGGG - Intronic
1101313119 12:103602094-103602116 TTGACAACACAGAATTTGGGGGG - Intronic
1101332800 12:103770783-103770805 ATTTCAACACAGGAATTTTGGGG - Intronic
1101860845 12:108481325-108481347 ATTTCAACATAGGAATTTTGGGG - Intergenic
1101973614 12:109335465-109335487 ATTTCAACATGAAATTTGGGTGG + Intergenic
1102713684 12:114951748-114951770 ATTTCAACATATGAATTTGGAGG - Intergenic
1102817664 12:115880825-115880847 ATTTCAACACATGAATTTTGGGG - Intergenic
1103247132 12:119467358-119467380 ATTTCAACATATGAATTTGGTGG - Intronic
1103426790 12:120842791-120842813 GTTTCAACATAGGAATTGGGTGG + Intronic
1103866711 12:124058105-124058127 ACTTCAACATATAAATTTGGGGG + Intronic
1104025163 12:125020492-125020514 ATTTCAACATAGGAATTTTGTGG + Intronic
1104237621 12:126954444-126954466 ATTTCAACATATGAATTTGGGGG - Intergenic
1104294462 12:127499473-127499495 CCTTCAACACACAAATTTGGGGG - Intergenic
1105250224 13:18692512-18692534 ATTTCAACATAGGAATTTTGGGG + Intergenic
1105415618 13:20208944-20208966 ATTTCAACACAGGAATTTCAGGG - Intergenic
1105508328 13:21030211-21030233 ATTTCAACATGAAATTTGGGTGG + Intronic
1105530511 13:21214938-21214960 ACTTCAACAGTGAATTTGGGGGG - Intergenic
1105639407 13:22246709-22246731 ATTTCAACACATGAATTTGGGGG + Intergenic
1105658621 13:22468840-22468862 ATGTCAACACAGGAATTTTGAGG - Intergenic
1105704676 13:22961632-22961654 ATTTCAACACAGAAATTCTGGGG - Intergenic
1105857630 13:24386680-24386702 ATTTCAACACAGGAATTCTGGGG - Intergenic
1105929348 13:25037581-25037603 ATTTCAACACAGAAATTTGCCGG + Intergenic
1106109575 13:26764861-26764883 GTTTCAACATAGAAATTTTGGGG + Intergenic
1106409186 13:29499133-29499155 GTTTCAGCACAGGAATTTGGGGG + Intronic
1106592369 13:31108981-31109003 ATTTCAACATATGAATTTGGGGG + Intergenic
1106749497 13:32745821-32745843 ATTTCAACATAGGAATTTTGGGG + Intronic
1106950197 13:34874772-34874794 ACTTCAACACATGAATTGGAGGG + Intergenic
1107041699 13:35955544-35955566 ATGTCAACATAGGAATTTGGGGG + Intronic
1107268615 13:38587643-38587665 ATTTCTAAATAGAAAATGGGAGG + Intergenic
1107331945 13:39310848-39310870 ATTTCAACATACAAATTTGAGGG + Intergenic
1107396578 13:40024358-40024380 ATTTCAACTTAGAAACTGGCAGG + Intergenic
1107498563 13:40953319-40953341 ATGTCAACATAGAATTTTGGGGG - Intronic
1107499732 13:40961362-40961384 ATTTTAAAACAGAAACTAGGAGG + Intronic
1107729119 13:43330568-43330590 ATTAAAACACAGAATTGGGGGGG - Intronic
1107735881 13:43398128-43398150 ATTTCAACATATGAATTTGGGGG + Intronic
1108017320 13:46089599-46089621 ATTTCAACATAGGAATTTTGGGG - Intronic
1108112556 13:47091692-47091714 ACTTCAACATATAAATTTGGGGG - Intergenic
1108118505 13:47157935-47157957 ATTTCAACATATGAATTTGGAGG - Intergenic
1108200812 13:48041230-48041252 ATTTCTACATAGAATTTTGGGGG - Intronic
1108417648 13:50215486-50215508 AATTAAAGACAGATATTGGGAGG + Intronic
1108897984 13:55359302-55359324 ATTTCAACATACTAATTGGTAGG - Intergenic
1108931720 13:55832519-55832541 GTTTCAACATATAAATTTGGGGG - Intergenic
1109044209 13:57387336-57387358 ATTACCACACTGAAATTGTGTGG + Intergenic
1109050335 13:57472610-57472632 ATTTCAACACAAAACTTGGTAGG + Intergenic
1109191962 13:59335728-59335750 ATTTCAGCACAGCAATTTTGGGG + Intergenic
1109357452 13:61248688-61248710 GTTTCAACACATAAATTTGGGGG - Intergenic
1109401037 13:61829180-61829202 ATTTCAAATCATAAATTTGGGGG - Intergenic
1109413482 13:62005520-62005542 ATTTGAACATACAAATTGGGAGG - Intergenic
1109497217 13:63188623-63188645 ATTTCAACATATAAATTTGGGGG + Intergenic
1109507710 13:63328436-63328458 AATTCAACATAAAATTTGGGTGG - Intergenic
1109739577 13:66534586-66534608 GTTTCAACATATAAATTTGGGGG + Intronic
1110187974 13:72697264-72697286 ATTACAACATAGAACTTGGCAGG - Intergenic
1110280515 13:73688201-73688223 TGTTCTACACAGAAAGTGGGAGG + Exonic
1110357795 13:74588639-74588661 ATTTCAACATATGAATTTGGAGG - Intergenic
1110521530 13:76484565-76484587 ATTTCAACACATAAACTTTGAGG + Intergenic
1110544144 13:76737622-76737644 ACTTCAACACAGGCATTTGGGGG - Intergenic
1110727321 13:78840158-78840180 ACTTCAACATAGGAATTTGGGGG + Intergenic
1110918778 13:81058305-81058327 ATTTCAAAACAGAGATTTTGGGG - Intergenic
1110959339 13:81601489-81601511 GTTTCAACATAGAAATTTTGGGG - Intergenic
1111065845 13:83090034-83090056 AATTCAACATACAATTTGGGTGG - Intergenic
1111258475 13:85704014-85704036 ATTTCAATATACAAATTTGGGGG - Intergenic
1111310836 13:86482979-86483001 ATTTCAACATAGGAATTTTGGGG - Intergenic
1111338626 13:86854919-86854941 ATTTCAACACTGAAAATTTGAGG - Intergenic
1111566689 13:90026549-90026571 AATTCAAGACATAATTTGGGTGG - Intergenic
1111802385 13:92996658-92996680 ATTTCAACACACATTTTGGAGGG - Intergenic
1111816444 13:93159912-93159934 ATTTCAACACAAGAATCTGGAGG + Intergenic
1111868220 13:93796616-93796638 ATTTCAAAACAAAGATGGGGAGG + Intronic
1111952978 13:94724816-94724838 ATTTAAAAACAGAGATTGGCCGG - Intergenic
1112163825 13:96896634-96896656 ATTTCAATACATGAATTTGGGGG - Intergenic
1112659359 13:101490061-101490083 ATTTCAACACAGAATTTTGGGGG - Intronic
1112763566 13:102717740-102717762 ATTTCAACACATAAATTTGGAGG - Intergenic
1112799082 13:103091097-103091119 ATTTCAACATACAAATTTTGGGG - Intergenic
1112821218 13:103338340-103338362 ATTTCAACATAGGAATTTTGGGG + Intergenic
1112951304 13:104999849-104999871 ATTTCAACATACAAATTTGAGGG + Intergenic
1113121288 13:106926154-106926176 ATTTCAACATATGAATTTGGGGG + Intergenic
1113236696 13:108283944-108283966 GTTTCAACATAGGAATTTGGGGG + Intronic
1113248562 13:108426053-108426075 ATTTCAACATAGGAATTTGGTGG + Intergenic
1113370171 13:109717064-109717086 ATTTCATCACATAAATTTGGAGG + Intergenic
1113789585 13:113020719-113020741 ATTTCAACACATGAATTCAGGGG + Intronic
1113933829 13:113982681-113982703 ATTTCAACCCACAGATTTGGGGG - Intronic
1113972916 13:114203909-114203931 ATTTCTACAGAGAAGTTGGCTGG - Intergenic
1114366078 14:22028498-22028520 ATTTCAACATATGAATTTGGGGG - Intergenic
1114381218 14:22206420-22206442 ATTTCAACACATGAATTTGCAGG - Intergenic
1114744078 14:25127975-25127997 ATTTCAAAATATGAATTGGGTGG - Intergenic
1114984216 14:28206768-28206790 ACTTCAACATAGAAATTTGGGGG + Intergenic
1115051118 14:29064681-29064703 ATTTCAACACATGAATGTGGGGG + Intergenic
1115188449 14:30719841-30719863 ATTTTATCACAGACATTGGATGG + Intronic
1115358897 14:32479641-32479663 ATTTCAACATATAAATTTGTAGG - Intronic
1115372245 14:32630010-32630032 ATTTAAACCCAGCTATTGGGAGG - Intronic
1115801917 14:37004253-37004275 ATTTCAAAATAGAATTTGGTGGG - Intronic
1116078723 14:40145709-40145731 ATTTCAACACACAAATTTTTAGG - Intergenic
1116113345 14:40615278-40615300 ATTTCAACAGATAAATTTGGGGG - Intergenic
1116260928 14:42625246-42625268 ATTTCAAGACATAATTTTGGAGG - Intergenic
1116319999 14:43449162-43449184 AATTCTACACGGAATTTGGGTGG + Intergenic
1116433944 14:44876185-44876207 ATTTCAACATAGGAATTTGGGGG + Intergenic
1116496489 14:45566819-45566841 GTTTCAACACATGAATTTGGGGG - Intergenic
1116503587 14:45650578-45650600 ATTTCAACATGAAATTTGGGGGG + Intergenic
1116620512 14:47197210-47197232 ATTTCAACATATAAATTTTGAGG - Intronic
1116637772 14:47418634-47418656 ATTTCAACATATAAATTTTGGGG + Intronic
1116987046 14:51231662-51231684 ACTTCAACACATGAATTTGGAGG + Intergenic
1117024151 14:51602968-51602990 ATTTCAACACATGAATTTTGAGG - Intronic
1117155419 14:52935384-52935406 ATTTCAACATATGAATTTGGGGG - Intronic
1117173841 14:53128566-53128588 ATTTCAACATACAAATTTTGGGG + Intronic
1117180299 14:53184567-53184589 ATTTAAAAACAAAAATTGGAGGG + Intergenic
1117266876 14:54098200-54098222 TTTCCAACACATAAATTTGGGGG + Intergenic
1117426616 14:55605163-55605185 ATTTCAACACAGAAATACTTGGG - Intronic
1117533017 14:56677135-56677157 ATGTCAACATAGGAATTTGGGGG + Intronic
1118021577 14:61721370-61721392 ATTTCAACACAGAAAAGTGCAGG - Intronic
1118244022 14:64090592-64090614 AGTTCTACACAGAAAGTGGAGGG + Intronic
1119140429 14:72262559-72262581 GTTTCAACATATAAATTTGGGGG + Intronic
1119167059 14:72503250-72503272 ATTTCAACATATAAATTTGAAGG + Intronic
1119181250 14:72606678-72606700 ATTTCAACACGGAATTTGGTGGG - Intergenic
1119875553 14:78056428-78056450 AGTTCAACACAAGATTTGGGCGG - Intergenic
1119881964 14:78106705-78106727 ATTTCAACATATAAATTTGGAGG - Intergenic
1120014513 14:79455340-79455362 ATTTCAACATAGGAATTTGCAGG + Intronic
1120093832 14:80365308-80365330 ATTTCAACATATACATTTGGGGG + Intronic
1120192456 14:81451796-81451818 ATTTCAACATATAAATTTTGAGG - Intergenic
1120227570 14:81808452-81808474 ATTTCAACACAAGATTTGGACGG - Intergenic
1120592840 14:86395567-86395589 ATTTCAACACGAAATTTGGAAGG + Intergenic
1120670119 14:87353669-87353691 GTTTCAACATATAAATTTGGGGG - Intergenic
1120847514 14:89139207-89139229 TCTTGAACACAGAAGTTGGGGGG + Intronic
1120877316 14:89386952-89386974 GCTTCAACATATAAATTGGGGGG + Intronic
1120923879 14:89779176-89779198 ACTTCAACATAGGAATTTGGGGG - Intergenic
1121081221 14:91109805-91109827 GCTTCAACACAGGAATTTGGAGG + Intronic
1121256063 14:92531273-92531295 ATTTCAACACATACATTTTGTGG - Intronic
1121505129 14:94471425-94471447 ATTTCCACAGAGAAATTGTTGGG - Intronic
1121825165 14:97004330-97004352 ATTTCAACATATGAGTTGGGTGG - Intergenic
1121881175 14:97501548-97501570 GTTTCAACATATAAATTTGGAGG - Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122437657 14:101710880-101710902 ATTTCAACACATAAATGTTGGGG - Intergenic
1122438537 14:101714682-101714704 AATTCAACACATGAATTTGGGGG + Intergenic
1202894427 14_KI270722v1_random:190470-190492 ATTTCAACATAGGAATTTGAGGG + Intergenic
1124056307 15:26243672-26243694 GTTTCAACACAGGAATTCTGAGG + Intergenic
1124062153 15:26303521-26303543 ATTTCAACATATGAATTTGGGGG + Intergenic
1124154124 15:27210062-27210084 ATTTCAACATATGAATTTGGGGG + Intronic
1124199938 15:27670578-27670600 ATTACAGTACAGAAATTGAGTGG + Intergenic
1124385654 15:29206366-29206388 ATTTCAACATAGAAATTCGGGGG + Intronic
1124412095 15:29445081-29445103 ATTTCAACATAGGAATTTTGGGG - Intronic
1124684848 15:31773576-31773598 ATTTCAACATATGAATTTGGGGG + Intronic
1125086286 15:35733866-35733888 AATTGAACACAGCAATTGGGAGG + Intergenic
1125768236 15:42149165-42149187 GCTTCAACACAGGAATTTGGAGG - Intronic
1126229302 15:46306729-46306751 ATTTCAACATATGAATTTGGGGG - Intergenic
1126301138 15:47197400-47197422 ATTTAAAAACAGAATTTGAGGGG - Intronic
1127068616 15:55266067-55266089 ATTTCAACATACAAATTTTGGGG - Intronic
1127174557 15:56339679-56339701 GTTTCAACATATAAATTGGCGGG - Intronic
1127764250 15:62169425-62169447 ATTTCAACATAGGAATTTGGTGG - Intergenic
1127985021 15:64062475-64062497 ATTTCAACATATGAATTTGGAGG + Intronic
1128458715 15:67849883-67849905 ATTTCAACATACAAATTTGGAGG - Intergenic
1128728833 15:70007024-70007046 ATTTCAACAGTGGAATTGGGAGG + Intergenic
1129129668 15:73482201-73482223 ATTTCAACACAAGATTTGGAGGG - Intronic
1129827883 15:78646775-78646797 ATTTCAACATATAAATTTAGAGG + Intronic
1130215913 15:81969367-81969389 ATTTCAACATACAAATTTTGGGG + Intergenic
1130450747 15:84049347-84049369 GTTTTAACACAGATATTGGATGG + Intergenic
1130687473 15:86051454-86051476 ATTTCAACATAGAAATTTTGGGG + Intergenic
1130774943 15:86969006-86969028 ATTTCAACAAATAAATTTTGAGG + Intronic
1131432455 15:92397546-92397568 ATTCTAAGTCAGAAATTGGGTGG + Intronic
1131570252 15:93527750-93527772 ATTTCAACATACAAATGTGGGGG - Intergenic
1131713612 15:95084015-95084037 ATTACAGCACTGAAATTGAGTGG + Intergenic
1131714101 15:95089892-95089914 GTTTCAACACAGGAATTTGAGGG - Intergenic
1132016807 15:98324979-98325001 ACTTCAACACATAAATTTTGGGG - Intergenic
1132119386 15:99163619-99163641 ATTTCAACACATGAATTTGAGGG - Intronic
1132121450 15:99179409-99179431 TTTTCAACACAGGCAATGGGCGG - Intronic
1132171888 15:99666726-99666748 TTTACAACACAGAAATAGTGTGG + Intronic
1133549501 16:6840478-6840500 ATTTCAACACACAAATTTAGGGG - Intronic
1134297227 16:12957634-12957656 ATTTCAACATATGAATTTGGGGG + Intronic
1134350134 16:13429653-13429675 AATTCAACATAGGAATTTGGGGG + Intergenic
1134861468 16:17564225-17564247 ATTTAAACACTGAAATAGTGTGG + Intergenic
1135018401 16:18943449-18943471 ATTTTAACACAGAAACTTGTGGG - Intergenic
1136287472 16:29252966-29252988 GTTTCAACACACACATTTGGGGG - Intergenic
1136748671 16:32614216-32614238 TTTTCAGCACAGAAATGAGGGGG - Intergenic
1137262836 16:46845024-46845046 ATTTAAACATAGAACCTGGGTGG - Intergenic
1137595183 16:49718873-49718895 ATTTCAACAAACGAATTTGGGGG + Intronic
1137636836 16:49994053-49994075 CTTTCAAGACAGAAATTGATTGG + Intergenic
1137978061 16:53047690-53047712 GTTTCAACATATAAATTTGGAGG + Intergenic
1138118244 16:54377474-54377496 ATTTCAACACAAGATTTGGAGGG - Intergenic
1138320125 16:56104664-56104686 ATTTCAGCATATAAATTTGGAGG - Intergenic
1138723070 16:59104766-59104788 ATTTCAACATAAGATTTGGGTGG - Intergenic
1138909852 16:61383528-61383550 ATTTCAACATAAGAATTTGGGGG - Intergenic
1139226402 16:65236435-65236457 ATTTCAACACAAAAATGTGTTGG + Intergenic
1139325102 16:66146409-66146431 ATTTCAACATATGAATTTGGGGG - Intergenic
1139604483 16:68008383-68008405 TTTTCAACAAAGAAATTGCAAGG - Intronic
1139950828 16:70668613-70668635 ATTTGAACAGAGGAATTTGGGGG - Intronic
1140020460 16:71233511-71233533 ATTTCAACACATGAATTTGGAGG - Intergenic
1140521888 16:75588779-75588801 ATTTCAACATAGGAATCTGGGGG + Intergenic
1140551709 16:75873094-75873116 ATTTCAACATAGGAATTTAGGGG + Intergenic
1140578038 16:76195729-76195751 ATTTCAACTCAGAAATTGCTGGG + Intergenic
1140800218 16:78480402-78480424 ATCTCAACACATTTATTGGGTGG + Intronic
1140815462 16:78616887-78616909 ATTTCAACATATAAATTTTGGGG + Intronic
1141051481 16:80768655-80768677 ATTTCAACATATAAATTTTGGGG + Intronic
1141215903 16:82023603-82023625 ATTTCAACATATAAAGTTGGGGG + Intergenic
1141240037 16:82257493-82257515 GTTTCAACATATAAATTTGGGGG - Intergenic
1141259796 16:82442004-82442026 ATTTCAATACATGAATTTGGGGG + Intergenic
1141535832 16:84679088-84679110 ATTTCAACCTAGGAATTTGGGGG - Intergenic
1142093090 16:88225595-88225617 GTTTCAACACACACATTTGGGGG - Intergenic
1203050804 16_KI270728v1_random:873430-873452 TTTTCAGCACAGAAATGAGGGGG - Intergenic
1142861168 17:2762711-2762733 ATTTCAACATAGAAATTTTGTGG + Intergenic
1142878871 17:2869158-2869180 ATTTCAACACAGAAATTTTAAGG + Intronic
1142949585 17:3466886-3466908 GTTTCAACATATAAATTGGGGGG + Intronic
1143570940 17:7757979-7758001 ATTTTAACATATAAATTTGGTGG + Intronic
1143972698 17:10806901-10806923 ATTTCAGCATATGAATTGGGAGG + Intergenic
1144671588 17:17135751-17135773 ATTTCAACACATGAGTTGTGGGG + Intronic
1144838781 17:18172880-18172902 ATTTCAACATGGGAATTTGGTGG + Intronic
1146178775 17:30684087-30684109 ATTTCAACATATAAATTTGGGGG - Intergenic
1148485850 17:47990528-47990550 ATGTCAACACAGAAGTTGATGGG - Intergenic
1149149341 17:53541332-53541354 ACTTCAACACATAAATTTGAAGG - Intergenic
1149327785 17:55550047-55550069 ATTTCAACATAGGAATTTGGAGG - Intergenic
1149344089 17:55716893-55716915 ATTTCAACATATAAATTGGGGGG - Intergenic
1149373603 17:56021530-56021552 ATTTCAACACACAAATTTAGGGG - Intergenic
1149439832 17:56664794-56664816 ATTTCAACACACGAATTTGGTGG + Intergenic
1149563349 17:57625168-57625190 ATTTCAACATAGAAATTTGGGGG + Intronic
1149603713 17:57910173-57910195 TCTTCAACACAGAAATTGTAAGG - Intronic
1149678790 17:58489118-58489140 ATTTGAAAACGGAAATTGGCCGG + Intergenic
1149765695 17:59276147-59276169 ATTTGAACAAATAACTTGGGAGG + Intergenic
1149852727 17:60050060-60050082 ATTTCAACATAGGAATTTTGGGG - Intronic
1150159479 17:62883734-62883756 ATTTCAATATATAAATTTGGAGG - Intergenic
1150166435 17:62948070-62948092 ATTTCAACATAGGAATTTTGGGG - Intergenic
1150391878 17:64794541-64794563 AATTCAAGATAGAAAGTGGGGGG - Intergenic
1150415342 17:64983735-64983757 GTCTCAACATAGAAATTTGGGGG - Intergenic
1150454911 17:65299550-65299572 ACTTCAACACAAAAATTTGGGGG - Intergenic
1150505440 17:65693758-65693780 ATTTCAACATACGAATTTGGAGG - Intronic
1150719002 17:67598433-67598455 ATTTTAACATAGGAATTTGGGGG - Intronic
1150788950 17:68184591-68184613 AATTCAAGATAGAAAGTGGGGGG - Intergenic
1150789296 17:68188129-68188151 ACTTCAACACATGAATTTGGCGG + Intergenic
1150841453 17:68610808-68610830 ATTTCAACACAAGATTTGGAGGG - Intergenic
1150907944 17:69358726-69358748 GTTTCAACACATGAATTTGGGGG - Intergenic
1150981082 17:70142454-70142476 ATTTCAACATGGGAATTTGGAGG - Intergenic
1151442659 17:74142645-74142667 ATTTAAATACAAAAAATGGGAGG - Intergenic
1151901829 17:77021054-77021076 ATTTCAACATAAGATTTGGGTGG - Intergenic
1152138742 17:78524030-78524052 ATTTCAACAGAGAAATTTTGGGG - Intronic
1152266739 17:79299288-79299310 ACTTCAACACAGGAATTTTGAGG - Intronic
1152941926 17:83177328-83177350 ATTTCAACACATGAATTTGGGGG - Intergenic
1153073787 18:1138088-1138110 ATTTCAGTACACAAATTTGGGGG + Intergenic
1153122312 18:1743769-1743791 CTTTCAACATATAAATTGTGGGG - Intergenic
1153148420 18:2059586-2059608 AATTCAAGACAGAAAATGGATGG - Intergenic
1153655759 18:7280744-7280766 ATTTCAACATATGAATTTGGGGG + Intergenic
1153780211 18:8488474-8488496 ATTTCAACATAAGATTTGGGCGG - Intergenic
1153912793 18:9718911-9718933 ATTTCAACATACAAATTTTGGGG + Intronic
1154368166 18:13730552-13730574 ATTAACACACATAAATTGGGGGG + Intronic
1154996185 18:21642410-21642432 ATTTCAACATATAAATTTTGGGG - Intergenic
1155051069 18:22148278-22148300 ATTTCAACACAAAAATGCAGTGG + Intergenic
1155254771 18:23985160-23985182 ATTTCAACATAGCAATTTTGGGG + Intergenic
1155254878 18:23986459-23986481 ATTTCAACACATAAATTTAGAGG - Intergenic
1155432231 18:25771493-25771515 ACTTCAACATATAAATTTGGAGG + Intergenic
1155466625 18:26142891-26142913 ATTTCAACATACGAATTTGGGGG + Intronic
1155627095 18:27846823-27846845 TTTTCAACACACAAACTTGGGGG + Intergenic
1155723883 18:29054444-29054466 ATTTCAACATGGAATTTGGACGG + Intergenic
1155770667 18:29694471-29694493 ATTTCAACATATGAATTGTGGGG - Intergenic
1155776256 18:29765681-29765703 GTTTCAACATACAAATTTGGGGG + Intergenic
1155935954 18:31754248-31754270 TTTACAACACATAAATTTGGGGG + Intergenic
1156068416 18:33174316-33174338 ATTTCAACATAAGATTTGGGTGG + Intronic
1156110429 18:33719603-33719625 ATTTCAACATATAAATTATGAGG - Intronic
1156609095 18:38705478-38705500 ATATCAACACAGAATTTTAGTGG + Intergenic
1156807905 18:41209071-41209093 ACTTCAACATATAAATTTGGCGG - Intergenic
1157082585 18:44542348-44542370 TTTTCTACACAGAAATTCTGGGG - Intergenic
1157187920 18:45556243-45556265 ATTTCAACATATAAATTTTGGGG + Intronic
1157301724 18:46484293-46484315 GTTTCAACATATAAATTTGGGGG - Intronic
1157337162 18:46749776-46749798 ATTTCAACATAGGAATTTTGGGG - Intronic
1157347483 18:46852931-46852953 CTTTCATCACAGATAATGGGAGG + Intronic
1157366823 18:47072605-47072627 ATTTCTACACAAAAATTAGCTGG - Intronic
1157532988 18:48438183-48438205 ACTTCAACACAGCAATTTGGAGG - Intergenic
1158004285 18:52654346-52654368 ATTGCAGCACAGAAATGGGGAGG + Intronic
1158090959 18:53713174-53713196 ATTGCAACACATAAATTTGGGGG - Intergenic
1158186890 18:54780711-54780733 ATTTCAACATACAGATTTGGGGG + Intronic
1158484969 18:57858082-57858104 ATTTCAACATATGAATTTGGGGG - Intergenic
1158869834 18:61675289-61675311 AATTCAAAACAGAGATTTGGGGG + Intergenic
1158883554 18:61804471-61804493 ATTTCAACAAATGAATTTGGAGG + Intergenic
1159137788 18:64357291-64357313 ATTTCAACATAGGAATTTTGGGG + Intergenic
1159746777 18:72245610-72245632 TTTTCAACACAGGAGTTTGGTGG - Intergenic
1159879709 18:73846686-73846708 TGTTCAACAAAGAAACTGGGTGG + Intergenic
1160001507 18:75028511-75028533 ACTTCAACACAGGAATTTGAGGG + Intronic
1160032815 18:75277742-75277764 ATTTCAACAGAGGAATTCGAGGG + Intronic
1160080253 18:75719792-75719814 AATTCAACACAAGATTTGGGTGG + Intergenic
1160113954 18:76059539-76059561 ATTTCAACATATGAATTTGGGGG - Intergenic
1160344358 18:78120733-78120755 ATTTCAACATGGGATTTGGGTGG - Intergenic
1160428276 18:78793181-78793203 GTTTCAACACAGGAATGGGGAGG + Intergenic
1161218289 19:3105630-3105652 ATTTTAACATAGGAATTTGGGGG + Intronic
1162979838 19:14231485-14231507 ATTTCAACATATAAATTTGGGGG + Intergenic
1164962229 19:32443368-32443390 GTTTCAACATATAAATTTGGTGG - Intronic
1164972272 19:32542802-32542824 ATTTCAACATGCAAATTTGGAGG - Intergenic
1165254003 19:34562088-34562110 ATTTCAACACAGGAATTTTGGGG + Intergenic
1166967845 19:46541033-46541055 ACTTCAACACAGGAATTTGGAGG + Intronic
1167757225 19:51420462-51420484 ACTTCAACACAGAAATTTGGTGG + Intergenic
1168413212 19:56152906-56152928 ATTTCAACATAGAATTTGAGAGG + Intronic
925320200 2:2960179-2960201 ATTCCAACATAGGAATTTGGAGG + Intergenic
925483332 2:4301279-4301301 ATTTCAACATATAAATTTGGGGG - Intergenic
925516776 2:4691828-4691850 ATTTCAACATAAAATTTTGGAGG + Intergenic
925584528 2:5450888-5450910 ATTTTAACATAGGAATTTGGGGG + Intergenic
925649224 2:6071417-6071439 ATTTCTCCACTGAAACTGGGTGG + Intergenic
925983562 2:9196672-9196694 ATTTCAACATATGAGTTGGGGGG - Intergenic
926575613 2:14577027-14577049 ACTTCAACACACAAATTTGAGGG + Intergenic
926589744 2:14728026-14728048 ATTTCAACACAAGATTTGGAGGG - Intergenic
926778295 2:16443917-16443939 ACTTCAACATACAAATTTGGGGG + Intergenic
926824890 2:16895989-16896011 ATTTATACACAAAAATGGGGGGG + Intergenic
926933869 2:18067505-18067527 ATTTCAACACATAATTTGGGAGG - Intronic
926996272 2:18739546-18739568 ATTTCAACAAATGAATTTGGAGG - Intergenic
927292944 2:21422442-21422464 ATTTCAACATAGGAATTTTGAGG - Intergenic
927311291 2:21634681-21634703 ATTTCAACACATGAATTTTGGGG - Intergenic
928055915 2:28054468-28054490 ATTTCAACATATAAATTTGGGGG - Intronic
928318867 2:30267372-30267394 ATTTCAACATGGGATTTGGGCGG + Intronic
928512876 2:32017827-32017849 ATTTCAACATATGAATTTGGGGG - Intronic
929035475 2:37687492-37687514 ATATTAACACAGAATTTGTGGGG - Intronic
929446390 2:42004600-42004622 ATTTCAACATATGAATTTGGGGG + Intergenic
929584493 2:43105282-43105304 ATTTCAACATATTAATTTGGGGG - Intergenic
929754402 2:44752056-44752078 ATTTCAACACAAGATTTGGAGGG + Intronic
930157699 2:48122816-48122838 ATTTCAACACGTAAACTTGGGGG - Intergenic
930605924 2:53493032-53493054 ATTTCAACACATGAATTTGGTGG - Intergenic
931466873 2:62497078-62497100 ATTTTAAAACAGATATTAGGAGG - Intergenic
932309278 2:70726855-70726877 AATCCAACACAGGAATTGGTAGG + Intronic
932314737 2:70772380-70772402 ACTTCAACACATAAATTTGAGGG - Intergenic
932926954 2:75987555-75987577 ATTTCAACATATAAATTCTGGGG + Intergenic
932958415 2:76383423-76383445 ATTTAAAGACATAAATTGGCTGG - Intergenic
933092914 2:78144292-78144314 ATTTCAACACATAAATTTAGGGG + Intergenic
933318864 2:80746988-80747010 ATTTCAACATAAGATTTGGGTGG - Intergenic
933349231 2:81132172-81132194 ATTTCTTCACAGAAATTTAGAGG + Intergenic
933376360 2:81484534-81484556 ATTTCAACACATGAATTTTGGGG - Intergenic
933544334 2:83691485-83691507 ACTTCAACATATAAATTTGGGGG + Intergenic
933609699 2:84421495-84421517 GTTTCAACACGCAAATTTGGGGG - Intergenic
933690702 2:85177304-85177326 ATTTCAACACAGGAATTTGGTGG + Intronic
933990359 2:87629331-87629353 AATTCAGTACAGAAATGGGGAGG - Intergenic
934536389 2:95137828-95137850 ATTTCAACATAAGATTTGGGTGG - Intronic
934930108 2:98415194-98415216 ATTTCAACATACAAATTTGGGGG + Intergenic
934944711 2:98531149-98531171 ATTTCAACACATAAATTTTGGGG + Intronic
934969264 2:98749953-98749975 ATTTCAACACCAGAATTTGGTGG - Intergenic
934987147 2:98895775-98895797 ATTTCAACACACGAATTTTGAGG - Intronic
935176668 2:100654883-100654905 ATTTCCACACAGGAATTTGCGGG + Intergenic
935235397 2:101134106-101134128 ATTTCAACAATGAATTTGGAGGG + Intronic
935326938 2:101946109-101946131 ATTTCAACAGAGGAATTTGGGGG - Intergenic
935553188 2:104479829-104479851 ATTTCAACAGAGGAATTTGGGGG - Intergenic
935559117 2:104543093-104543115 ATTTCAACATATGAATTTGGGGG - Intergenic
935607376 2:104984570-104984592 ATTTCAACACAGGAATTTTGGGG - Intergenic
935716483 2:105943655-105943677 ATTTCAACATAGAAATTGTGGGG + Intergenic
935868649 2:107420480-107420502 ATTTCAAGACATAAAGTTGGGGG - Intergenic
936029274 2:109058582-109058604 ATTGCATCACAAAAATGGGGAGG - Intergenic
936163484 2:110101857-110101879 AATTAAACACAGCATTTGGGGGG + Intronic
936303487 2:111321493-111321515 AATTCAGTACAGAAATGGGGAGG + Intergenic
936348476 2:111693851-111693873 ATTTCAAAAAATAAAATGGGAGG + Intergenic
936395775 2:112127794-112127816 ATTTCTACAAAGAAGTTGGCAGG - Intergenic
936406838 2:112212309-112212331 ATTTCAACACATGAATTTTGGGG + Exonic
936599844 2:113884951-113884973 TTTTCAACACACAAATTGGTTGG + Intergenic
936892926 2:117393164-117393186 ATTTCAACATATGAATTTGGAGG + Intergenic
936904829 2:117525109-117525131 ACTTCAACCCAGAATTTGGAAGG + Intergenic
936965240 2:118121345-118121367 GTGTCAACACAGAAAGTTGGTGG + Intergenic
937425698 2:121796813-121796835 ATTTCAACACATAAATTTTGGGG + Intergenic
937442420 2:121927935-121927957 ATTTCAACATATGAATTTGGTGG + Intergenic
937554329 2:123134312-123134334 ATTTCAACATATACATTTGGCGG + Intergenic
937713776 2:125009164-125009186 ATTTCAACATATGAATTGGGGGG - Intergenic
937795920 2:126019949-126019971 ATTTCAACATATAAATTTGTGGG - Intergenic
938227504 2:129628466-129628488 ATTTCAACATAAGATTTGGGTGG - Intergenic
938955060 2:136289498-136289520 ATTTCAACATATAAATTTTGAGG + Intergenic
939104355 2:137932137-137932159 ATTTCAACATAGGAATTTGGGGG + Intergenic
939124186 2:138155873-138155895 ATTTCAACATATAAATTTTGGGG - Intergenic
939425526 2:142031744-142031766 ATTTCAACACATAAAATCAGGGG - Intronic
939455953 2:142435846-142435868 GTTTCAACACAGAAATTTTGGGG - Intergenic
939712740 2:145543224-145543246 AATTCAACACAGAATTTTGGTGG - Intergenic
939813919 2:146870707-146870729 ATTTCAACATATTAATTTGGGGG + Intergenic
940093062 2:149943830-149943852 ATTTCAACATGTAAATTTGGGGG - Intergenic
940373204 2:152924311-152924333 GGTTCAGGACAGAAATTGGGGGG + Intergenic
940570208 2:155422303-155422325 ATTTCAACATACAATTTTGGGGG + Intergenic
941209394 2:162617650-162617672 ATCTCAACACAGAAATTGTTTGG + Intronic
941262658 2:163317255-163317277 ATTTCCACACAAAAATTAGATGG - Intergenic
941597550 2:167496662-167496684 ATTTCAACACAGGAATTTTGAGG - Intergenic
941962825 2:171270215-171270237 AATTCAACACAAGATTTGGGTGG + Intergenic
942120465 2:172771357-172771379 ATTTCAACATATGAATTTGGGGG + Intronic
942189318 2:173455330-173455352 ACTTCAACACAGAATTTTGAGGG + Intergenic
942466086 2:176208723-176208745 GTTTCAACATAGGAATTTGGTGG + Intergenic
942525011 2:176843702-176843724 ATTTCAACACGTGAATTTGGAGG + Intergenic
942783411 2:179672546-179672568 ATTTCAACATAAAATTTGGGAGG - Intronic
942934695 2:181541055-181541077 ATTTCAATACAGGAATTTGAGGG - Intronic
943465681 2:188226455-188226477 ATTTCAACACATGAATTCTGAGG - Intergenic
943517214 2:188904270-188904292 ATTTCAACATATAAATTTTGGGG - Intergenic
943541877 2:189225747-189225769 AGTTGAACACAGAATTTGGAGGG + Intergenic
943550538 2:189333542-189333564 ACTTCAACATAGAATTTTGGGGG - Intergenic
943660117 2:190550451-190550473 ATTTCAACATATAAATTTTGGGG + Intergenic
943883880 2:193185782-193185804 ATTTAAAAACATAAATTTGGGGG - Intergenic
943893356 2:193320577-193320599 ATTTCAACATAAAATTTGGGTGG - Intergenic
943990267 2:194680634-194680656 ATTTCAATATATAAATTGTGGGG + Intergenic
944087904 2:195870561-195870583 ATTTCAACATATAAATTTAGGGG - Intronic
944154624 2:196596415-196596437 ATTTCAACACATGAATTTGGGGG - Intergenic
944306298 2:198183786-198183808 AATTCAACATAGGATTTGGGTGG - Intronic
944366272 2:198923390-198923412 GTTTCAACACAGTAATTGACTGG - Intergenic
944390811 2:199217624-199217646 ATTTCAACACGAAATTTGGGTGG - Intergenic
944467637 2:200018933-200018955 ATTTCAACATATAAATTTTGGGG + Intergenic
944871547 2:203917345-203917367 ATTTCAACATAGGAATTTTGAGG + Intergenic
944940029 2:204614591-204614613 AATTCAACATAAAATTTGGGTGG - Intronic
945704787 2:213215923-213215945 ATTTCAACATATGAATTTGGTGG - Intergenic
945935215 2:215896907-215896929 ATTTCAACATATGAATTTGGGGG + Intergenic
946045873 2:216820589-216820611 ATTTCAACATAGAAACTGGGGGG - Intergenic
946318982 2:218937722-218937744 ATTTCAACAAATGAATTTGGGGG - Intergenic
946619290 2:221544161-221544183 ATTTCAACATATAAATTCGAAGG + Intronic
946679001 2:222193984-222194006 ATTTCAACATAAAAATTTGGGGG + Intergenic
946808559 2:223497474-223497496 ATTTCAACATACAAATTTTGGGG - Intergenic
946909785 2:224448272-224448294 ATTTCAATATACAAATTGTGGGG - Intergenic
947047448 2:226004637-226004659 GTTTCAACACATAAATTTTGAGG + Intergenic
947378675 2:229523623-229523645 ACTTCAACATACAAATTTGGGGG + Intronic
947557347 2:231106717-231106739 ATTTAAGCACACAAATTTGGAGG + Intronic
947614450 2:231546244-231546266 ACTTCAACACAGGAATTTGGGGG + Intergenic
947744275 2:232499625-232499647 GCTTCAACACAGGAATTTGGGGG + Intergenic
947889940 2:233608456-233608478 ATTTCAACACTTGATTTGGGAGG + Intergenic
947895364 2:233666312-233666334 ATTTCAACACTTGATTTGGGAGG + Intronic
948003581 2:234589284-234589306 ATTTCAACACGAGATTTGGGTGG + Intergenic
948159150 2:235809957-235809979 TTTTAAACACAGAGATAGGGAGG + Intronic
948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG + Intergenic
948731491 2:239966597-239966619 ATTTGCACACAGATATTTGGGGG - Intronic
948914874 2:241029524-241029546 ATCTCAACATAGGAATTTGGGGG + Intronic
1169408543 20:5347215-5347237 ATTTCAACATATAAATTTTGGGG + Intergenic
1169534929 20:6527513-6527535 ATTTCCAGACACAAATTGTGGGG + Intergenic
1169548288 20:6673667-6673689 ATTTCAACATATGAATTTGGAGG + Intergenic
1169684110 20:8251264-8251286 GTTTCAACATAGGAATTTGGGGG + Intronic
1169761926 20:9104892-9104914 TGTACAAGACAGAAATTGGGAGG - Intronic
1170022345 20:11850394-11850416 ATTTCAACATATGAATTTGGCGG - Intergenic
1170181299 20:13533226-13533248 ATTTAAACTCAGTATTTGGGTGG - Intronic
1170725091 20:18919118-18919140 ATTTCAATACAAGATTTGGGTGG - Intergenic
1170796967 20:19556191-19556213 GTTTCAACATATAAATTTGGGGG + Intronic
1172329711 20:34066804-34066826 GTTTCAACACACAGATTTGGTGG + Intronic
1172582490 20:36059258-36059280 ATTTCAACATAGGAATTTGGGGG + Intergenic
1173929334 20:46805648-46805670 ACTTCAACATATAAATTTGGGGG + Intergenic
1174099186 20:48114245-48114267 ATTGCAACATATAAATTTGGGGG - Intergenic
1174250354 20:49214850-49214872 ATTTCAACACATGAATTTGTGGG + Intergenic
1174542078 20:51297562-51297584 ACTTCAACATATAAATTTGGGGG - Intergenic
1174650394 20:52119963-52119985 ATTTCAACATATGAATTGTGGGG - Intronic
1174825792 20:53767179-53767201 ATTTCAACAGATGAATTTGGAGG - Intergenic
1174864116 20:54119039-54119061 ACTTCAACATATAAATTGTGGGG + Intergenic
1175039467 20:56033292-56033314 ACTTCAACATAGGAATTTGGGGG + Intergenic
1175503198 20:59464763-59464785 AATTCAACACAAGATTTGGGTGG - Intergenic
1175590733 20:60189937-60189959 ATTTCAACATAGGAATTTTGAGG - Intergenic
1175680959 20:60988590-60988612 ATTTCAACATAGGAATTTTGTGG - Intergenic
1176049312 20:63108288-63108310 ATTTCAACATAGGAATTTGGGGG - Intergenic
1176727361 21:10449948-10449970 ATTTCAACATAAAATTTTGGCGG + Intergenic
1176921809 21:14696776-14696798 ATTTCAATATAGAAATTTAGGGG - Intergenic
1177142393 21:17371047-17371069 ATTTCAACAGATAAATTTTGGGG - Intergenic
1177338410 21:19763646-19763668 ATTTCAGCACATGAATTTGGGGG - Intergenic
1177427345 21:20940549-20940571 ATTTCATTACAGAAAATGTGTGG - Intergenic
1177495305 21:21881616-21881638 GTTTCAACACAGATACTGGAAGG + Intergenic
1177657725 21:24041110-24041132 ATTTCAACATACAAATTTGTAGG - Intergenic
1177781765 21:25629584-25629606 ATTTCAACACATCAATTTTGGGG + Intergenic
1178033214 21:28551754-28551776 ATTTCAACATATAAATTTGGGGG + Intergenic
1178255178 21:31045610-31045632 ATTCCAACATAGGAATTTGGAGG + Intergenic
1178369921 21:32018785-32018807 GTTTCAACATATAAATTTGGGGG + Intronic
1178624302 21:34202533-34202555 CTTTCAACCCAGAAATCGTGGGG + Intergenic
1178639221 21:34332812-34332834 GCTTCAACATATAAATTGGGAGG + Intergenic
1178686475 21:34715226-34715248 ATCTCAACACAGGAATTGGGAGG - Intronic
1178772034 21:35514488-35514510 ATTTCAACACATGAATTGGGTGG - Intronic
1179067459 21:38039366-38039388 ATTTCAACGCAGGAACTGGGGGG - Intronic
1179442564 21:41405604-41405626 GTTTCAACATGTAAATTGGGGGG + Intronic
1179622434 21:42626096-42626118 ATTTCACCTTAGAAATTGGTGGG - Intergenic
1181384425 22:22533486-22533508 ATTTCAACATAGGAATTGAGGGG - Intergenic
1181411969 22:22730482-22730504 ATTTTAACACATGAATTGGAGGG - Intergenic
1181476571 22:23171481-23171503 ATTTCAACATACAAATTTTGGGG + Intergenic
1182030994 22:27159318-27159340 GTTTCAACATACGAATTGGGAGG - Intergenic
1182245117 22:28951232-28951254 GTTTCAACATATAAATTTGGGGG - Intronic
1182332576 22:29561455-29561477 ATTGCAGCAGGGAAATTGGGGGG + Intronic
1182820785 22:33214401-33214423 ACTTCAACATACAAATTTGGGGG + Intronic
1182853381 22:33495857-33495879 ATTTCAACATAGGAGTTTGGAGG - Intronic
1182962196 22:34485654-34485676 ATTTCAACATGATAATTGGGTGG + Intergenic
1183112421 22:35660134-35660156 ACTTCAACATATGAATTGGGAGG - Exonic
1183327379 22:37201782-37201804 ACTTCAACATAGAAATTTAGAGG + Intergenic
1183761377 22:39821972-39821994 ATTTCAACTAAGAATTTGGGAGG + Intronic
1184417649 22:44361568-44361590 ATTTCAACACATGAATTTTGGGG - Intergenic
1184437366 22:44487497-44487519 ATTTCAACACACAAATATTGAGG + Intergenic
1184740565 22:46426600-46426622 ATTTCAATATAGCAATTTGGGGG + Intronic
1185098649 22:48825797-48825819 TTTTCTGCACAGAAACTGGGAGG - Intronic
1185176484 22:49330231-49330253 GTTTCAACACAGACATTCTGGGG - Intergenic
949105981 3:199794-199816 ATTTCAACAAAGCAATTTTGGGG - Intronic
949127845 3:467921-467943 AATTCAACACAAAATTTGGGTGG + Intergenic
949134673 3:549704-549726 GTTTCAACATATAAATTTGGAGG - Intergenic
949319643 3:2794986-2795008 ATTTTAACAGAGAATTTGAGGGG + Intronic
949362681 3:3248047-3248069 GTTTCAACACGGATTTTGGGGGG + Intergenic
949589903 3:5483130-5483152 ATTTCAACATATGAATTTGGGGG + Intergenic
949596653 3:5554955-5554977 CTTTCAACATATGAATTGGGGGG - Intergenic
949657196 3:6234283-6234305 ATTTCAATACATAAATTCTGAGG - Intergenic
949833826 3:8246384-8246406 ATTTCAGCACATGAATTTGGAGG - Intergenic
949917918 3:8979232-8979254 TTTCCAACACATAAATTTGGGGG - Intergenic
950896611 3:16457789-16457811 TTTCCAACACATAAATTTGGGGG - Intronic
950988569 3:17405095-17405117 ATCTCCAAACAGAAATTGGTAGG - Intronic
951240549 3:20281412-20281434 ATTTCGAGAAAAAAATTGGGAGG - Intergenic
951319842 3:21231204-21231226 ATTGCAACATAGGAATTTGGGGG - Intergenic
951548343 3:23851844-23851866 ATTTCAACACAGGATTTGGAGGG - Intronic
951572130 3:24075529-24075551 AGTTCATCACAGATATTGGTCGG + Intergenic
951752723 3:26055249-26055271 ACTTCAACATATAAATTTGGGGG + Intergenic
951905012 3:27697117-27697139 ATTTCAACACATACATTTCGAGG - Intergenic
952141001 3:30479211-30479233 ATTTCAACATACAAATTTTGGGG + Intergenic
952434266 3:33256741-33256763 GTTTCAACAGAGAATTTTGGGGG - Intergenic
952553799 3:34508796-34508818 ATTTGAACTCAGAAAGAGGGTGG + Intergenic
952585518 3:34887607-34887629 GTTTCAACACATAAATTTAGGGG - Intergenic
952671964 3:35980119-35980141 GTTTCAACACATGAATTTGGGGG + Intergenic
953152744 3:40340152-40340174 ATTTCAACACATGAATTTTGGGG - Intergenic
953467595 3:43137121-43137143 GTTTCAACACATAAATTTGAGGG + Intergenic
954123390 3:48514100-48514122 ACTTCAACATATAAATTGGTGGG + Intergenic
954643359 3:52115542-52115564 ATTTCAACACAGGAATTTTGGGG - Intronic
954900762 3:54017348-54017370 ATTTCAACATAGGAATGGGTGGG - Intergenic
955081878 3:55665357-55665379 ATTTCAACACATGAATTCTGAGG - Intronic
955105381 3:55892897-55892919 ATTTCAACATATGAATTGTGGGG - Intronic
955633443 3:61000052-61000074 ATTTCAACATAGAAATGTTGGGG + Intronic
955671527 3:61407920-61407942 ATTTCAACATATAAATTGGTGGG + Intergenic
955802552 3:62701136-62701158 ATTTCAACATATGAATTTGGGGG + Intronic
955965292 3:64382869-64382891 GTTTCAACATATGAATTGGGGGG - Intronic
955979162 3:64507515-64507537 ATTTCAACATACAAATTCTGGGG - Intergenic
956118287 3:65940606-65940628 ATTTCAACATATAAATTTTGGGG + Intronic
956227411 3:66975125-66975147 ATTTTAACATAAAATTTGGGCGG + Intergenic
956285332 3:67602883-67602905 ATTACGAAAAAGAAATTGGGAGG + Intronic
956289006 3:67642151-67642173 ATTTCAACATAGGAATTTTGTGG + Intronic
956342152 3:68237378-68237400 ATTTCAACATATGAATTTGGAGG + Intronic
956393446 3:68799466-68799488 ATTTCAACACATGAATTTTGAGG + Intronic
956498687 3:69857355-69857377 ATTTAAAGAAAGAAACTGGGGGG - Intronic
956538536 3:70307507-70307529 GTTATAACATAGAAATTGGGGGG - Intergenic
956631740 3:71323376-71323398 ATCCCAACACAGAAACTGGGAGG + Intronic
956676639 3:71739930-71739952 ATAACAGCACAGAAGTTGGGAGG + Intronic
956949461 3:74264585-74264607 ATTTCAACAAAGAATTTGGGGGG - Intronic
956966580 3:74468707-74468729 AGTTCGACACAGGAATAGGGAGG + Intronic
957191800 3:77019433-77019455 ATTTCAACATATGAATTTGGGGG + Intronic
957217791 3:77344353-77344375 ATTTCAACACATGAATTTTGTGG - Intronic
957260147 3:77890252-77890274 ATTTCAATACATAAATTTTGGGG + Intergenic
957444440 3:80296613-80296635 ATTTCAACATAGGATTTGGTGGG + Intergenic
957740385 3:84260051-84260073 ATTTCAACATATAAATTTGGGGG - Intergenic
957783272 3:84848118-84848140 ATATCAACATATAAATTTGGAGG - Intergenic
958099790 3:88994523-88994545 ATTTCAATACATAAATAGAGAGG - Intergenic
958156615 3:89762909-89762931 GTTTCAACACATGAATTCGGGGG - Intergenic
958185557 3:90115244-90115266 TTTCCAACACAGAACTTTGGGGG - Intergenic
958472355 3:94536879-94536901 GTTTCAACATATAAATTTGGGGG - Intergenic
959215053 3:103440673-103440695 ATAACAACACAGAAATTAGAAGG - Intergenic
959223243 3:103549197-103549219 ATTTCAACATAGGAATTTGGAGG - Intergenic
959332317 3:105021859-105021881 TTTTCAATACATAAATTTGGTGG - Intergenic
959420618 3:106124054-106124076 ATTTCAACATATGAATTTGGGGG - Intergenic
959517878 3:107290298-107290320 ATTTCAACACATGAATTTTGGGG - Intergenic
959567977 3:107852356-107852378 GTTTCAACATATAAATTTGGGGG - Intergenic
959593778 3:108106775-108106797 ATTTAAATAAAGAAATAGGGAGG + Intergenic
959638160 3:108599636-108599658 ATTTCAACACTGAATGAGGGGGG - Intronic
959714467 3:109417351-109417373 ATTTCAACATAGAAATTTTGGGG + Intergenic
959830994 3:110862298-110862320 ATTTCAACATACAAATTTGTGGG + Intergenic
960268314 3:115647018-115647040 ATTTCAACAGAGGAAATGTGAGG - Intronic
961099123 3:124183540-124183562 ATTTCAACATAAGATTTGGGTGG + Intronic
961747361 3:129073089-129073111 ATTCCAAGACAGAAAGTGGGTGG + Intergenic
962107560 3:132407931-132407953 ATTTCAACATACAAATTTTGGGG - Intergenic
962203842 3:133419275-133419297 ATTTCAGCACAGGAATTTGGGGG + Intronic
962301209 3:134244781-134244803 ATTTCAACATAGAAATTTTGGGG - Intronic
962607649 3:137045715-137045737 ATTTCAACACAGGAATTTCGGGG + Intergenic
962687940 3:137865433-137865455 ATTTCAACAAATGAATTTGGAGG + Intergenic
962914612 3:139888632-139888654 ATTTCAACACAAGATTTGGAAGG + Intergenic
963231719 3:142915008-142915030 ATTTCAACATAGGAATTTTGGGG + Intergenic
963232999 3:142927648-142927670 ACTTCAACACATGAATTGTGGGG + Intergenic
963349216 3:144132066-144132088 ATTTCAACATAAGATTTGGGTGG + Intergenic
963467908 3:145705424-145705446 GTTTCAACACATGAATTTGGGGG - Intergenic
963486781 3:145944639-145944661 ATTTCAACAAAGAAATAGATAGG + Intergenic
963511587 3:146254602-146254624 ATTTCAACATGAAATTTGGGAGG - Intergenic
963564129 3:146906302-146906324 ATTTCAACACATCAATTTTGGGG + Intergenic
963645994 3:147915418-147915440 GTTTCAACATACAAATTGGGAGG + Intergenic
963793286 3:149605930-149605952 ATTTCAACATATGAATTTGGTGG - Intronic
964119387 3:153166449-153166471 CTGTCAAAACAGAAATTGGGTGG + Exonic
964277296 3:155022050-155022072 ATTTCAACATATAAACTTGGAGG + Intergenic
964529761 3:157654824-157654846 ATTTCAACATACAAATTTTGAGG + Intronic
964809919 3:160652449-160652471 ATTTCAACATATGAATTGGGTGG - Intergenic
965004419 3:163000537-163000559 ATATCAACATATAAATTGTGGGG + Intergenic
965133201 3:164727240-164727262 ATTTCAACACATAAATCTGGGGG + Intergenic
965396889 3:168170525-168170547 ATTTCAACATAAGACTTGGGTGG + Intergenic
965465215 3:169021077-169021099 ATTTTAACACAAAAAATTGGGGG + Intergenic
965675941 3:171196564-171196586 TTTTCAACACATAAATTGCAAGG + Intronic
966001078 3:174949179-174949201 ATTTCAGCATAGGAATTTGGGGG + Intronic
966087417 3:176085292-176085314 ATTTTAACATACAAATTTGGGGG + Intergenic
966110469 3:176394927-176394949 ATTTCAAGACAGAGAGTGGTTGG + Intergenic
966118567 3:176495939-176495961 ATTTGAACACAAATACTGGGAGG + Intergenic
966119130 3:176502543-176502565 ATTTCAACATGTAAATTGGGAGG + Intergenic
966480750 3:180405651-180405673 ATTTCAACATATGAATTTGGGGG + Intergenic
967042435 3:185705893-185705915 ATTTCAACATAAGAATTTGGGGG + Intronic
967129012 3:186453478-186453500 ATTTCAACACATGAATTGGGGGG - Intergenic
967177242 3:186872396-186872418 TTTCCAACACATAAATTTGGGGG + Intergenic
967256950 3:187603173-187603195 ATTTCAACATACAATTTTGGGGG - Intergenic
967755095 3:193159859-193159881 ATTTCAACATATAAATTTGGTGG - Intergenic
967989790 3:195122252-195122274 ATTTCAACACATGAATTTTGGGG + Intronic
968507327 4:976889-976911 ATGTCAACATAGAATTTTGGGGG - Intronic
969142021 4:5084105-5084127 ATTTAAATACAGAGATTGGAGGG - Intronic
969343917 4:6559594-6559616 ATTTCAACATAGGAATTCAGGGG - Intronic
969391769 4:6896129-6896151 ATTTCAACATATAAATTTGGTGG - Intergenic
969398272 4:6937458-6937480 ATTTCAACATGTGAATTGGGTGG + Intronic
969515577 4:7646343-7646365 ATTTCAACATAGGAATTTTGGGG - Intronic
969950379 4:10829596-10829618 ATTTCAACATATAAATTTGGGGG - Intergenic
970128757 4:12843397-12843419 ATTTCAACACATAAATTTTGAGG + Intergenic
970558705 4:17261211-17261233 ATTTCAACATATGAATTTGGGGG + Intergenic
970779311 4:19716843-19716865 ACTAGAACACAGAAATTGAGGGG - Intergenic
970786714 4:19805738-19805760 ACTTCAACATATAAATTTGGGGG + Intergenic
970954163 4:21791367-21791389 ATTTCAACACAGGAATTGCGGGG + Intronic
970968785 4:21957632-21957654 ATTTCAACATATGAATTTGGGGG - Intergenic
971032891 4:22660129-22660151 ATTTCAACATATGAATTTGGGGG + Intergenic
971075588 4:23145226-23145248 ATTTCAACATATGAATTTGGGGG - Intergenic
971209672 4:24603595-24603617 ATTTCAGCACTGAAACTGGCGGG + Intergenic
971324660 4:25634089-25634111 ATTTCAACACATGAATTTGGGGG + Intergenic
971500650 4:27314659-27314681 ATTTCAACATATAAATTTGGGGG - Intergenic
971581538 4:28347713-28347735 ATTTCAACATAGGAATTTTGAGG + Intergenic
971786001 4:31103622-31103644 TTTTAAAGACAGAAATTGGGAGG - Intronic
971822757 4:31580094-31580116 ATTTCAACACATGAATTTGTGGG - Intergenic
971920515 4:32933280-32933302 ATTTCAACATACACATTTGGGGG + Intergenic
972007644 4:34131291-34131313 ATTTCAACATAAAATTTGGACGG - Intergenic
972042221 4:34616887-34616909 ATTTCAACATATGAATTTGGAGG + Intergenic
972352102 4:38245387-38245409 ATTTCAACACATGAATTTTGGGG - Intergenic
972389444 4:38600918-38600940 ATTTCAACACATGAATCTGGAGG + Intergenic
972855788 4:43105211-43105233 ATTTCAAGACAAGATTTGGGTGG - Intergenic
972911395 4:43821867-43821889 ATTTCAACATAAGATTTGGGTGG + Intergenic
973057632 4:45680175-45680197 ATTTCAAAAAAAAAATTGGGAGG + Intergenic
973097277 4:46217905-46217927 ATTTCAACATATAAATTTTGTGG + Intergenic
973755329 4:54068226-54068248 ATATCAACATACAAATTTGGGGG - Intronic
973801923 4:54486950-54486972 ATTTCAACATATGAATTTGGAGG - Intergenic
973987588 4:56370050-56370072 ATTTCAACATACAAATTTGAGGG - Intronic
974138428 4:57850448-57850470 ATCTCAACACAGAACTTGGTGGG - Intergenic
974220567 4:58964293-58964315 AATTCAACATGGAATTTGGGTGG + Intergenic
974364537 4:60929202-60929224 TTTAAAACACAGAAATTGGCTGG + Intergenic
974696476 4:65381682-65381704 ACTTCAACATACAAATTTGGCGG - Intronic
974980391 4:68949177-68949199 ATTTCAACACAGGATTTTGTAGG + Intronic
975224246 4:71851857-71851879 ATTTCATCACATAAATTTGGGGG + Intergenic
975320346 4:73003479-73003501 ATTTCAACACATGAATTTTGGGG - Intergenic
975761524 4:77625052-77625074 ATTTCAACATAGGAATTTTGAGG - Intergenic
975955903 4:79838146-79838168 ACTTCAACATACAAATTTGGTGG + Intergenic
976318532 4:83685438-83685460 ATTTCAACATAGAATTTTGGAGG + Intergenic
976376366 4:84350030-84350052 ATTTCAACATATAAACTGGGGGG + Intergenic
976664141 4:87572066-87572088 ATTTCAACATAGGAATTTTGGGG + Intergenic
976668759 4:87628639-87628661 ATTTCAACAAATGAATGGGGGGG - Intergenic
976704297 4:88005858-88005880 ACTTCAACACAGAAATTTTTGGG - Intergenic
977067374 4:92334728-92334750 ATTCCAACACATAAATTTTGGGG + Intronic
977494607 4:97759244-97759266 TTCTGAACACAAAAATTGGGAGG + Intronic
977589127 4:98807275-98807297 ATTTCAACATGTGAATTGGGAGG - Intergenic
977718464 4:100210267-100210289 ATTTCAACAAACAAATGGGGAGG + Intergenic
977779299 4:100961744-100961766 ATTTCAACATAGGAATTTTGTGG - Intergenic
977901487 4:102427095-102427117 ATTTCAACAAAGAAGGTGTGAGG + Intronic
978227876 4:106360573-106360595 ATTTCAACACATGAGTTTGGCGG - Intergenic
978444796 4:108770164-108770186 ACTTCAACACAGAATTTTGGGGG - Intergenic
979018570 4:115466389-115466411 ATTTCAACACATGAATTTGGGGG - Intergenic
979071925 4:116219263-116219285 ATTTCAACATATGAATTTGGGGG - Intergenic
979098061 4:116575854-116575876 ATATCAACACAATAATTGTGGGG - Intergenic
979282170 4:118880370-118880392 ATTTTAACACTGATTTTGGGGGG + Intronic
979447697 4:120834239-120834261 ATTTCAACATATGAATTTGGGGG - Intronic
979749206 4:124256056-124256078 ATTTCAACATAGGCATTAGGAGG - Intergenic
979752429 4:124295431-124295453 ATTTCAACACATAAATTTTGAGG - Intergenic
979766152 4:124466502-124466524 ATTTTAACAAAGGTATTGGGTGG - Intergenic
979915760 4:126431385-126431407 ATTTCAACATGAGAATTGGGCGG + Intergenic
980332603 4:131428796-131428818 ATTTCAACATCTAAATTTGGTGG - Intergenic
980347034 4:131634769-131634791 ATTTCAACATATAAATTTTGGGG + Intergenic
980451856 4:132984183-132984205 TTTTCAACACACAAACTGTGGGG - Intergenic
980693898 4:136330799-136330821 CTTACAAGACAGAAATTGGTGGG + Intergenic
980729596 4:136809948-136809970 TTTTCAACACATAAATTTTGGGG + Intergenic
980838109 4:138222565-138222587 ATTTAAAAAAAGAAATTGAGAGG - Intronic
981038599 4:140197909-140197931 ATTTCAGCATACAAATTTGGGGG - Intergenic
981338946 4:143598131-143598153 ATTTCAGCATATAAATTTGGGGG + Intronic
981772903 4:148330715-148330737 ATTTCAACACAAGATTTGGAGGG - Intronic
981795055 4:148586056-148586078 ATTAAAACAAAGAGATTGGGTGG - Intergenic
982069354 4:151681971-151681993 ATTTCAACACAGGAATTTGGGGG + Intronic
982203719 4:152981651-152981673 ATTTCAACACAGGAATTTGAGGG - Intergenic
982251630 4:153413170-153413192 ACTTCAACATACAAATTTGGGGG + Intronic
982325463 4:154124918-154124940 ATTTCAACATATAAATTTGGGGG + Intergenic
982327168 4:154140339-154140361 ATTTCAACACATGAATTTTGGGG - Intergenic
982392188 4:154876855-154876877 ACTTCAACAGAGGAATTTGGAGG - Intergenic
983031823 4:162812088-162812110 ATTTCAACACATAAATTTTGGGG + Intergenic
983058103 4:163123331-163123353 ATTTCAACACAAGATTTGGAGGG + Intronic
983278671 4:165652414-165652436 ACTTCAACACATGAATTTGGAGG - Intergenic
983698130 4:170557828-170557850 ATTTCAACATGAAATTTGGGTGG - Intergenic
983769938 4:171536646-171536668 ATTTAAACATACAAATTGTGGGG - Intergenic
983887846 4:173000877-173000899 ATTTCAACATATAAATTTTGGGG - Intronic
983892944 4:173049540-173049562 ATTTCAATATATAAATTTGGGGG + Intergenic
983920381 4:173337588-173337610 ACTTCAACATAGAAAGTTGGTGG - Intergenic
984237394 4:177176710-177176732 ATTTCAACATATAAATTGGTAGG - Intergenic
984336657 4:178401157-178401179 ATTTCAACATAGGATTTTGGGGG - Intergenic
984386921 4:179072470-179072492 ATTTCAACATATAAATTTTGAGG + Intergenic
985238721 4:187905841-187905863 ATTTCAACACACAAATTTTGGGG + Intergenic
985360514 4:189170978-189171000 GTTTCAACATATAAATTGTGAGG + Intergenic
985751532 5:1681428-1681450 ATTTCAACATAAGATTTGGGTGG + Intergenic
986000725 5:3628769-3628791 ATTTCAGCAGAGGAATTTGGGGG - Intergenic
986020831 5:3800581-3800603 ATTTCAACATAGGAATTTTGAGG + Intergenic
986196826 5:5544367-5544389 ATTTCAACACAGACATTTTTTGG + Intergenic
986755576 5:10832861-10832883 GTTTCAACATAGAAATTTAGCGG + Intergenic
986862805 5:11947884-11947906 ATCTCAACACATAAATTTGGGGG + Intergenic
987036504 5:14024130-14024152 ACTTCAACAGAGAAATTTGGGGG + Intergenic
987624504 5:20380911-20380933 ATTTCAACATATAAATTTAGGGG - Intronic
987689070 5:21244080-21244102 ATTTCAATATAAAAATTGGAGGG - Intergenic
987833563 5:23131113-23131135 GTTTCTTCAGAGAAATTGGGTGG - Intergenic
987833932 5:23136509-23136531 ATTTTAACATAGAAATATGGGGG + Intergenic
988049719 5:26011264-26011286 ATTTCAACATATAAATTTTGAGG + Intergenic
988250098 5:28745913-28745935 AACTAAAGACAGAAATTGGGAGG + Intergenic
988393535 5:30666695-30666717 ATTTCAACATATAAATTTTGGGG + Intergenic
988402793 5:30783470-30783492 ATTTAAACAATGAAATAGGGAGG + Intergenic
988515363 5:31899658-31899680 ATTTCAACATATGAATTAGGGGG - Intronic
988634690 5:32970160-32970182 GTTTCAACATATGAATTGGGGGG + Intergenic
988802648 5:34711041-34711063 ATTTCAACAGAGTAATTTTGAGG - Intronic
988904643 5:35773734-35773756 ATTTCATCACAGATGCTGGGAGG + Intronic
989207686 5:38827808-38827830 ATTTCAACAGATGAATTTGGTGG - Intergenic
989312764 5:40039576-40039598 ATTTCAACATATAAATTGGTGGG + Intergenic
989323008 5:40159045-40159067 ATTTCAACAAATAAATTTTGAGG - Intergenic
989440311 5:41463489-41463511 ATTTCAACATATAAATTTTGGGG + Intronic
989680554 5:44023543-44023565 TTTCCAACACATAAATTTGGGGG - Intergenic
989703413 5:44298176-44298198 GTTTCAACATAGAAATTTTGGGG - Intergenic
989706613 5:44340215-44340237 GCATCAACACAGAATTTGGGAGG + Intronic
989978820 5:50617096-50617118 ATTTCAATATACAAATTCGGGGG - Intergenic
990074180 5:51822444-51822466 ATTTCAATAAATACATTGGGTGG - Intergenic
990097565 5:52135764-52135786 GTTTCAACATATAAATTTGGAGG + Intergenic
990841269 5:60082146-60082168 ATTTCAACATATAAATTTTGGGG - Intronic
991335860 5:65546560-65546582 ATTTCAACATAGGAATTTGGGGG - Intronic
991419079 5:66422468-66422490 ACTTCAACATATAAATTTGGAGG - Intergenic
991514218 5:67415900-67415922 ATTTCAACATAGGAATTTCGAGG + Intergenic
991673471 5:69070341-69070363 ATTTCAACAAATAAATTTCGGGG - Intergenic
991773653 5:70062778-70062800 ATTTGAACACAGGAATTTGAGGG + Intronic
991852947 5:70938202-70938224 ATTTGAACACAGGAATTTGAGGG + Intronic
992212797 5:74497027-74497049 ATTTCAACCTAGAAATTTTGAGG - Intergenic
992266037 5:75019069-75019091 ATTTCAACATACGAATTTGGGGG - Intergenic
992268205 5:75038789-75038811 ATTTCAACACATGAATTTTGGGG + Intergenic
992727285 5:79620961-79620983 ATTTAAAAACAGAACTTGAGAGG + Intronic
992761985 5:79958706-79958728 ATTTCAACATAGGAATTTGGGGG - Intergenic
992807766 5:80354279-80354301 GTTTCAACATATGAATTGGGGGG + Intergenic
993172340 5:84435125-84435147 ATTTCAACATATGAATTTGGGGG - Intergenic
993344848 5:86770018-86770040 ATTTCAACATGAAATTTGGGTGG + Intergenic
993419715 5:87685465-87685487 ATTTCAACATATGAATTTGGGGG + Intergenic
993465070 5:88235404-88235426 ATTTCAACACAAGAATTTGAGGG - Intronic
993664131 5:90673769-90673791 ATTTTAACATAGGAATTTGGGGG + Intronic
993831602 5:92766564-92766586 TTTTCAACACATAAATTTTGGGG + Intergenic
993914806 5:93731162-93731184 ACTTCAACACATAAATTTGGTGG - Intronic
993943778 5:94094465-94094487 GTTTCAACATACAAATTGGAGGG + Intronic
994397635 5:99238805-99238827 ATTTTAACACATAAATTTTGAGG + Intergenic
994471837 5:100217157-100217179 GTTTCAACATATAAATTTGGGGG - Intergenic
994507867 5:100664841-100664863 ATTTCAATATAAGAATTGGGTGG + Intergenic
994516284 5:100776514-100776536 ATTTTAACATATAAATTTGGCGG - Intergenic
994697128 5:103086358-103086380 ACTTCAACACAAATTTTGGGAGG + Exonic
994771006 5:103981579-103981601 ATTTCAACATATAAATTTAGTGG - Intergenic
994900038 5:105759867-105759889 AATTCAACATAAGAATTGGGTGG - Intergenic
994955908 5:106532127-106532149 ATTTCAACATGGGATTTGGGGGG - Intergenic
995634179 5:114166733-114166755 ATTTCAACATATGAATTTGGAGG - Intergenic
996256056 5:121404056-121404078 ATTTCAACATATAAATTGTTGGG - Intergenic
996261284 5:121472863-121472885 ATTTCAACATATAAATTGTGGGG - Intergenic
996683612 5:126255881-126255903 ATTTCAACACGTAAATTCTGGGG + Intergenic
996993728 5:129668638-129668660 ATTTCAACATATAAATTATGGGG + Intronic
997043061 5:130280171-130280193 GTTTCAACACATGAATTTGGAGG - Intergenic
997046798 5:130329054-130329076 AATTCAACATAAAATTTGGGTGG - Intergenic
997208715 5:132065455-132065477 ATTTTAACATACAAATTTGGAGG - Intergenic
997452971 5:133998372-133998394 ATTTCAATACAAAAATTAGCCGG + Intronic
997842774 5:137257295-137257317 ATTTCAACACATAAATTTTGGGG - Intronic
998288769 5:140891708-140891730 TTTTCAACACATGAATTTGGGGG - Intronic
998465532 5:142341022-142341044 ACTTCAACATATTAATTGGGTGG + Intergenic
999807908 5:155101038-155101060 ACTTCAACATAGGAATTGGGGGG - Intergenic
999962722 5:156774548-156774570 ATTTCAACATACAAATTTGGGGG + Intergenic
1000424947 5:161079721-161079743 TTTTCAACACAAAATTTGGAAGG - Intergenic
1001251684 5:170151842-170151864 TTTTCAACACAGGAATTTTGGGG - Intergenic
1002365940 5:178710899-178710921 ATTTGAACACAGGGATTTGGGGG + Intergenic
1002601913 5:180358649-180358671 ATTTCAACATATAAATTTGGGGG - Intergenic
1002848683 6:971832-971854 ACTTCAACACAGGAATTTTGAGG + Intergenic
1003113419 6:3267149-3267171 ATTTAAACACAAAAAATGGCCGG - Intronic
1003235287 6:4289761-4289783 GCTTCAACACAGAAATTTGGGGG + Intergenic
1003317979 6:5028714-5028736 ATTTCAACATAGGAATTTGGGGG - Intergenic
1003400935 6:5790309-5790331 ACTTCAACAGTGAATTTGGGGGG + Intergenic
1003423588 6:5980621-5980643 ATTTCAACATACACATTTGGGGG - Intergenic
1003438794 6:6121008-6121030 ATTTCAACATAAAATTTGGAGGG - Intergenic
1003622165 6:7709964-7709986 ATTTTAACATAAAAATTTGGGGG + Intergenic
1003675489 6:8200910-8200932 GTTTCAACAGATAAATTTGGGGG - Intergenic
1003735977 6:8877981-8878003 ATTTCAACACAGGAATTTAGGGG + Intergenic
1003852801 6:10242261-10242283 ATTTCAACATACAAATTGGAGGG + Intergenic
1003977995 6:11362038-11362060 ACTTCAACATATAAATTTGGGGG - Intronic
1004021552 6:11780285-11780307 ATTTCAACATAGGAATTTGCAGG + Intronic
1004224861 6:13776130-13776152 GTTTCAACACAGGAATTTGGGGG - Intergenic
1004241968 6:13931805-13931827 ATTTCAACATATGAATTTGGAGG - Intronic
1004756959 6:18620872-18620894 GTTTCAACATATAAATTTGGAGG - Intergenic
1004914948 6:20322848-20322870 ATTTCAATACATAAATTTTGAGG - Intergenic
1005082684 6:21972703-21972725 ATTTCAACATAGGAATTTTGGGG + Intergenic
1005146391 6:22695347-22695369 ACTTCAACATATAAATTTGGAGG + Intergenic
1005161050 6:22864044-22864066 ATTTCAACATAGAAATTTTGAGG + Intergenic
1005239933 6:23812540-23812562 ACTTCAACATATGAATTGGGAGG + Intergenic
1005249345 6:23926849-23926871 ATTTCAACATAGAAATTTGGAGG + Intergenic
1005301975 6:24480022-24480044 ATCTCATCACAGAAAATTGGTGG - Intronic
1005309847 6:24548932-24548954 ATTTCAACACATGAATTTGTGGG - Intronic
1005387271 6:25297943-25297965 CTATTAACACAGAAAATGGGAGG - Intronic
1007038095 6:38696669-38696691 ATTTCAACACATGAATTTTGAGG + Intronic
1007255578 6:40525889-40525911 ATTTCAGCACAGAAATGGAAAGG - Intronic
1007303169 6:40883983-40884005 ACTTCAACACAGAACTTCTGAGG + Intergenic
1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG + Intergenic
1007367500 6:41405341-41405363 ATTCCAACATACAAATTTGGGGG + Intergenic
1007867366 6:44987271-44987293 GCTTCAACATATAAATTGGGCGG + Intronic
1007972703 6:46068591-46068613 ATTTCAACATACAAACTTGGGGG - Intronic
1008198288 6:48553472-48553494 ATTTCAAGGCATAAATTGGTAGG + Intergenic
1008543759 6:52567957-52567979 ATTGCGAGTCAGAAATTGGGAGG - Intronic
1008722170 6:54368038-54368060 ATTTCAACATAGGAATTTTGGGG + Intronic
1009397601 6:63217928-63217950 ATTTCCATATAGAAATTTGGGGG + Intergenic
1009519621 6:64664571-64664593 ATTTCAACATATGAATTTGGGGG - Intronic
1009556067 6:65168642-65168664 ATTTCAACACAGAAATGTAGAGG + Intronic
1009786498 6:68347157-68347179 ATTTCAACATAAAGATTGGAGGG - Intergenic
1010278353 6:73994787-73994809 ATTTCAACATATGAATTTGGGGG + Intergenic
1010515156 6:76763350-76763372 ATTTTCACACAAAAATTGAGAGG - Intergenic
1010533977 6:77002780-77002802 ATTTCAACATATAAATTTGGGGG + Intergenic
1010653369 6:78480711-78480733 ATTTCAACATATAAATTTGGGGG + Intergenic
1011753673 6:90478022-90478044 GTTTCAACACATGAATTTGGGGG - Intergenic
1011849863 6:91612965-91612987 ATTTTAACATAAAAATTGTGGGG - Intergenic
1011937143 6:92794211-92794233 GTTTCAACACATAAATTTTGGGG - Intergenic
1012364750 6:98424932-98424954 ATTTCAACATACAAATTCTGAGG - Intergenic
1012512388 6:100018063-100018085 ATTTCAAAACACACATTTGGAGG + Intergenic
1012766999 6:103379849-103379871 ATTTCAACATAAGATTTGGGAGG + Intergenic
1012785269 6:103617266-103617288 ATTTCAACACATGAATTGTAGGG - Intergenic
1013303571 6:108827168-108827190 AATTCAACATAGGATTTGGGTGG - Intergenic
1013447979 6:110250512-110250534 ATTTCAACATATTAATTTGGGGG + Intronic
1013805266 6:113989563-113989585 ATTTCAACATATGAATTAGGAGG + Intronic
1013862286 6:114650234-114650256 TTTCCAACACACAAATTGTGAGG + Intergenic
1014056646 6:117023921-117023943 ATTTCAACATATGAATTTGGGGG - Intergenic
1014075096 6:117226455-117226477 ATTTTAACACATAAATTTTGCGG + Intergenic
1014518475 6:122408117-122408139 GTTTCAACATAGAATTTTGGGGG + Intronic
1014809007 6:125864515-125864537 ATTTCAACATGTAAATTTGGGGG - Intronic
1015138904 6:129907925-129907947 ATTTCAACATATAAATTTTGGGG - Intergenic
1015436303 6:133193207-133193229 ATTTCAACACAAATTTTGGAGGG - Intergenic
1015639335 6:135314149-135314171 ATTTTAACACATGAATTTGGGGG - Intronic
1015776387 6:136818988-136819010 ATTTCAACATATGAATTTGGGGG + Intergenic
1015903536 6:138092352-138092374 ATTTCAAGGCAGAAACTTGGTGG - Intronic
1015927896 6:138328648-138328670 ACTTCAACATAGGAATTTGGGGG + Intronic
1016026663 6:139294433-139294455 ATTTCAACACATGAATTTTGGGG - Intergenic
1016134824 6:140527259-140527281 ACTTCAACATACAAATTTGGTGG - Intergenic
1016186000 6:141197868-141197890 ACTTCAACATATAAATGGGGTGG + Intergenic
1016195770 6:141337338-141337360 ATTTCAACATACAAATTTGGGGG - Intergenic
1016221399 6:141674839-141674861 ATTTCGATACATAAATTTGGGGG + Intergenic
1016571268 6:145515695-145515717 ATTTCAACATATAAATCTGGGGG + Intronic
1016586034 6:145687105-145687127 ATTTCAACATATAAATTTTGGGG - Intronic
1016646528 6:146415348-146415370 ATTTCAATGCATAAATTTGGAGG + Intronic
1016667819 6:146663541-146663563 ATTTCAACACATGAATTTTGGGG + Intronic
1017018967 6:150124973-150124995 ATTTCAACATAAGATTTGGGTGG - Intergenic
1017474264 6:154772383-154772405 ATTTCAAAACAAAGATTTGGAGG + Intronic
1017489174 6:154929478-154929500 ATTTAAAGACAGAAATTGTTAGG + Intronic
1018256177 6:161921780-161921802 ATTTCAACACAGTGACTGGCTGG - Intronic
1018263476 6:161994039-161994061 ATTTCAACATAAGATTTGGGTGG + Intronic
1018452836 6:163925091-163925113 ATTTCAACATAGGAATTTTGAGG - Intergenic
1018540837 6:164877449-164877471 ATTTTAACACATGAATTGTGGGG + Intergenic
1018591309 6:165426163-165426185 ATTTCTACAAAGAAATCAGGTGG - Intronic
1018761810 6:166899863-166899885 ATTTCAACACAGGAATTGGGGGG - Intronic
1018979086 6:168588542-168588564 ATTTCAACACAGGAATTTTGAGG + Intronic
1019202859 6:170333173-170333195 TTTTCAATACAGGAATTGCGGGG - Intronic
1020090468 7:5336386-5336408 ATTTCACCAGAGAAATAGGAAGG + Intronic
1020390227 7:7649750-7649772 ATTTCAGCATATGAATTGGGTGG - Intronic
1020541906 7:9469369-9469391 AATTCAACATAAAACTTGGGTGG - Intergenic
1020569494 7:9841047-9841069 ATTTCAACATATAAATTTGTAGG + Intergenic
1020736623 7:11957390-11957412 ATTTCAACACGAAATTTGGAGGG + Intergenic
1021225474 7:18021293-18021315 ATTTCAACACAGGAATTTTGGGG - Intergenic
1021345434 7:19521565-19521587 ATTTCAACATACAAATTTTGGGG - Intergenic
1021605372 7:22404319-22404341 GTTTCAACATATAAATTTGGGGG + Intergenic
1022500418 7:30879114-30879136 GTTTCAACACAGGAATTTTGGGG - Intronic
1023040293 7:36167218-36167240 GCTTCAACACAGGAATTTGGGGG + Intronic
1023153582 7:37225342-37225364 ATTTCAACACATATATTGTAAGG + Intronic
1023174802 7:37425395-37425417 ATTTCAACATAAGAATTTGGAGG + Intronic
1023340138 7:39211182-39211204 ATTTCAACATAAAAACTTGGTGG + Intronic
1023384973 7:39647587-39647609 ATTTCAACATACAAATTTGGGGG - Intronic
1024130800 7:46350700-46350722 TTTTCAGCACAGAGACTGGGGGG + Intergenic
1024250742 7:47504012-47504034 GTTTCAACACAGGAATCTGGGGG + Intronic
1024537755 7:50452105-50452127 ATTTCAACATACAAATTTTGGGG - Intronic
1024849266 7:53691068-53691090 ATTTCAACATATCAATTGGAGGG + Intergenic
1025079827 7:55972007-55972029 AAATAAACACAGAAATTGGCTGG + Intronic
1025109726 7:56203896-56203918 ATTTCAACACACAGATTTGGGGG + Intergenic
1025929971 7:65985654-65985676 ATTTCAACACAACACTTGGTGGG + Intergenic
1026003130 7:66578741-66578763 ATTTCAACATATGAATTTGGAGG + Intergenic
1026013044 7:66651865-66651887 ACTTCAACATATAAATTTGGTGG - Intronic
1026028470 7:66767554-66767576 ATTTCAACATATGAATTTGGGGG - Intronic
1026103842 7:67405249-67405271 ATTTCAACATATAAATTTGAAGG + Intergenic
1026536472 7:71242577-71242599 ATTTCAACATGGAGATTTGGAGG + Intronic
1027209803 7:76136684-76136706 ATTTCAACATATGAATTTGGAGG + Intergenic
1027278554 7:76588085-76588107 ATTTCAACATATATTTTGGGAGG + Intergenic
1027301089 7:76836573-76836595 ATTTCAACACATGAACTTGGAGG + Intergenic
1027473953 7:78606906-78606928 ATTTAAAATTAGAAATTGGGAGG - Intronic
1027771843 7:82416787-82416809 AATTCAACACAGGAATTTTGGGG + Intronic
1028049742 7:86168133-86168155 AATTCAACACAAGATTTGGGTGG + Intergenic
1028478135 7:91274022-91274044 ATTTCAACATAATATTTGGGGGG + Intergenic
1028505065 7:91561519-91561541 ATTTCAACATATAAATTTGGGGG + Intergenic
1028635164 7:92980131-92980153 ACTTCAACACATAAATTTTGGGG + Intergenic
1029031741 7:97475446-97475468 ATTTCAACATAGAAATTGGGGGG - Intergenic
1029152633 7:98491747-98491769 GCTTCAACACATAAATTTGGAGG - Intergenic
1029863306 7:103599000-103599022 ATTTTAACCTAGAATTTGGGGGG - Intronic
1029892825 7:103949321-103949343 ATTTTAACATATAAATTTGGTGG - Intronic
1030145509 7:106350086-106350108 ATTTCAACATATGAATTTGGGGG - Intergenic
1030173274 7:106626211-106626233 AATTCACCTCAGAAAATGGGAGG + Intergenic
1030195201 7:106846461-106846483 ATTTCAACATAAGAATTTGGTGG - Intergenic
1030442704 7:109607994-109608016 AATTCAGCAAAGGAATTGGGGGG + Intergenic
1030533660 7:110739594-110739616 ATGGCAACACAGTAATTGTGGGG + Intronic
1030791266 7:113731857-113731879 ATTTCAACATATAAATTTTGCGG + Intergenic
1030880288 7:114869288-114869310 ATTTCAACATAAATATTGGAGGG + Intergenic
1031038950 7:116818506-116818528 ATTTCCACCCAGAAATTGAGAGG + Intronic
1031213569 7:118861254-118861276 ATTTCAACATATAAATTTGAGGG + Intergenic
1031232953 7:119133954-119133976 ATTTCAACATAGAAATTTGGTGG - Intergenic
1031523227 7:122792227-122792249 ATTTCAACACATGAATTTTGGGG - Intronic
1031634835 7:124090222-124090244 GTTTCAACACATGAATTTGGGGG - Intergenic
1031980165 7:128119611-128119633 ATTTCAACATATGAATTAGGAGG - Intergenic
1032687950 7:134254657-134254679 ATTTCAACATAGGAATTTGTGGG + Intronic
1032882110 7:136100918-136100940 GTTTCAACATAGGAATTGAGGGG - Intergenic
1033013737 7:137650482-137650504 ATTTCAACATAAAAATTTTGAGG - Intronic
1033366546 7:140676346-140676368 ATTTCAACAAAGGAATTTTGGGG + Intronic
1033706061 7:143885782-143885804 ATATAAACACAGAAATTGTATGG + Intronic
1033773535 7:144581005-144581027 GTTTCAACAGATGAATTGGGAGG - Intronic
1033872604 7:145774605-145774627 ATTTCATCACATAAACTTGGGGG - Intergenic
1033891013 7:146013142-146013164 ATTCCAACCAAAAAATTGGGAGG - Intergenic
1034033452 7:147793692-147793714 ATTTCTACAAAGAAATCAGGTGG + Intronic
1034103262 7:148469298-148469320 ACTTCAACATATGAATTGGGAGG + Intergenic
1034232035 7:149537965-149537987 ATTTCAACATACAAATTTGAGGG - Intergenic
1034385307 7:150736198-150736220 ATTTTCACACAGAGACTGGGAGG - Intronic
1034402729 7:150876243-150876265 ATTTCAACACATGAATTTGAGGG + Intergenic
1034511228 7:151536635-151536657 ATTTCAACATATGAATTTGGCGG - Intergenic
1034842197 7:154409136-154409158 ATTTTAACATATAAATTGGCAGG - Intronic
1035529914 8:342955-342977 ATTTCAACAGATAAACTTGGGGG + Intergenic
1036626992 8:10480365-10480387 ACATCAACACAGGAATTTGGGGG - Intergenic
1036628226 8:10490693-10490715 ATATTAAAATAGAAATTGGGAGG + Intergenic
1036971447 8:13359773-13359795 ATTTCACCAGAGAAGTTGGGTGG + Intronic
1037102242 8:15061138-15061160 ATTTCAACACATGAGTTTGGGGG - Intronic
1037223208 8:16551560-16551582 ATTTTGACACATAAATTTGGAGG + Intronic
1037610417 8:20471428-20471450 ATTTCAACAAATGAATTTGGTGG - Intergenic
1037867671 8:22459720-22459742 ATTTCAACATACAAATTCTGGGG - Intronic
1038096918 8:24323306-24323328 ATTTCAACACATGAATTTTGGGG + Intronic
1038284849 8:26197593-26197615 ATTTCAACACATATTTTGGGAGG + Intergenic
1038340145 8:26679316-26679338 ATTTCAACAAAGGAATTTTGGGG + Intergenic
1038431357 8:27502871-27502893 ACTTCAACACAGGAATTTTGGGG + Intronic
1038491866 8:27977250-27977272 ATTTCAACATAGGAATTTGGAGG + Intronic
1038766146 8:30429526-30429548 ATTTCACTACAAAAATTTGGGGG - Intronic
1038927995 8:32161625-32161647 ATTAAAACACTGAGATTGGGAGG - Intronic
1039224197 8:35369902-35369924 ATTGCAACACAGAAAATAAGTGG - Intronic
1039343860 8:36682301-36682323 ATTTCAACACATGAATTTTGGGG + Intergenic
1039370564 8:36980029-36980051 GGTTCAACATAGAAATTTGGAGG + Intergenic
1040010501 8:42657419-42657441 ATTTTAACATATAAATTGGGAGG + Intergenic
1040366660 8:46724283-46724305 ATTTCAACATATGAATTTGGGGG + Intergenic
1040548911 8:48423371-48423393 ATTTCAACACATAAATTTTGGGG + Intergenic
1040674743 8:49735055-49735077 CTCTCAACACAGTAAGTGGGAGG + Intergenic
1040825178 8:51612528-51612550 ATTTCAACACAGGTATTTGGGGG - Intronic
1040830157 8:51667067-51667089 AATTCTAGAAAGAAATTGGGTGG - Intronic
1040857391 8:51961990-51962012 ATTTCAACATATGAATTTGGTGG + Intergenic
1040946596 8:52891691-52891713 ACTTCAACATAGGAATTTGGGGG - Intergenic
1041040945 8:53845168-53845190 ATTTCAACACAGGAATTTTGGGG + Intergenic
1041070064 8:54119700-54119722 ATTTCAACATATGAATTTGGGGG - Intergenic
1041407683 8:57518094-57518116 ATTTCAACATATGAATTTGGAGG + Intergenic
1041461211 8:58113700-58113722 GTTTCAACATACAAATTTGGGGG + Intronic
1041777969 8:61545125-61545147 ATTTCAACATATGAATTTGGGGG - Intronic
1041882722 8:62770625-62770647 ATTTTAACATATAAATTTGGGGG + Intronic
1042027924 8:64443645-64443667 ATTTCAACAAATGAATTTGGGGG - Intergenic
1042357236 8:67841550-67841572 GTTTCAACATATAAATTTGGGGG + Intergenic
1042395167 8:68283632-68283654 ATTAAAAGACAGAAATTGGCAGG - Intergenic
1042606970 8:70555337-70555359 ATTTCAACATATATATTTGGGGG - Intergenic
1042935195 8:74051564-74051586 ATTGCAACACAGGAATTTTGGGG - Intergenic
1042990301 8:74631989-74632011 GTTTCAACATATAAATTTGGAGG + Intronic
1043359209 8:79451403-79451425 ATTTCTATACAAAATTTGGGAGG + Intergenic
1043360965 8:79471434-79471456 ATTTCAACATACAATTTGGTGGG + Intergenic
1044064420 8:87682163-87682185 ATTTCAACATATAAATTTGAAGG - Intergenic
1044085235 8:87935548-87935570 ATTTTAACATATAAATTTGGGGG + Intergenic
1044184145 8:89231959-89231981 ATTTCAACATATAAATTTGGGGG + Intergenic
1044282520 8:90373150-90373172 ACTTCAACACATAAATTTTGGGG - Intergenic
1044646151 8:94445323-94445345 ATTTCAACATATAAATGTGGGGG + Intronic
1045030135 8:98127234-98127256 ATTTCAACACTGGAATTTTGGGG + Intronic
1045687112 8:104723567-104723589 ATTTCCATACAGAAATGAGGAGG + Intronic
1045748314 8:105451406-105451428 ATTTGAACATATAAATTTGGCGG - Intronic
1045834936 8:106508722-106508744 ATTTTAATTCAGGAATTGGGTGG - Intronic
1045912479 8:107426362-107426384 ATTCTAAAACAGAAAGTGGGCGG + Intronic
1045921557 8:107535976-107535998 ATTTCAACATATAAATTTGAGGG + Intergenic
1046060071 8:109128464-109128486 ATTTCAACATATGAATTTGGTGG + Intergenic
1046262013 8:111781003-111781025 ATTTCAACATAAAATTTGGAGGG - Intergenic
1046321493 8:112582708-112582730 ATTTTAACATACAAATTTGGGGG - Intronic
1046327209 8:112664595-112664617 ATTTCAACATAGAAATTTGGGGG - Intronic
1046388804 8:113540743-113540765 ATTTCAACATAGGAATTAGAGGG + Intergenic
1046419750 8:113964850-113964872 ATTTCACCACAGAAATTTTTAGG - Intergenic
1046592296 8:116221055-116221077 GTTTCAACATAGGAATTTGGAGG - Intergenic
1046612651 8:116443056-116443078 ATTTTAACTCTGAAATTTGGAGG + Intergenic
1046794773 8:118359095-118359117 ATTTTAACATATTAATTGGGGGG - Intronic
1046796263 8:118376287-118376309 ATTTCAATACATAAATTTTGAGG - Intronic
1046937379 8:119897630-119897652 ATTCCTACAAAGAAAGTGGGAGG - Intronic
1047000004 8:120564169-120564191 GCTTCAACACATGAATTGGGTGG - Intronic
1047118353 8:121870706-121870728 ATTTCAACATATAAATTTTGTGG + Intergenic
1047202183 8:122776358-122776380 ATTTCAACATATGAATTGGGGGG + Intergenic
1047542695 8:125785576-125785598 ATTGCAACACTGAAACAGGGAGG - Intergenic
1047606557 8:126480268-126480290 ATTTTAACATACAAATTTGGGGG + Intergenic
1047635723 8:126759855-126759877 ATTTCAACACAAGATTTGGAGGG + Intergenic
1047636339 8:126767434-126767456 AATTCAACACAAGATTTGGGTGG - Intergenic
1047857244 8:128924917-128924939 GTTTCAACATATAAATTTGGTGG - Intergenic
1047962591 8:130021651-130021673 ATTTCAACTTACAAATTGTGGGG + Intergenic
1048096364 8:131299848-131299870 ATTTCAACATGAAATTTGGGTGG + Intergenic
1048130890 8:131695512-131695534 ATTTCAACATGAAATTTGGGTGG + Intergenic
1048149057 8:131875585-131875607 ATTCTCTCACAGAAATTGGGAGG - Intergenic
1048349160 8:133602018-133602040 ATTTCAACATAAGAATTTGGGGG + Intergenic
1048398916 8:134044894-134044916 ATGTCAAAAAAGAAATTAGGAGG + Intergenic
1048431073 8:134371536-134371558 ATTTCAACACATAAATTTTGGGG - Intergenic
1048651005 8:136477645-136477667 ATTTCAACATATGAATTTGGGGG - Intergenic
1048714207 8:137249572-137249594 ATTTGAAGTCAGAAAATGGGAGG - Intergenic
1048939350 8:139384933-139384955 ATTTAAACACACAGATTGGAAGG - Intergenic
1049045973 8:140151682-140151704 AGTTCAACACAGGAATGCGGTGG + Intronic
1049153497 8:141052190-141052212 ATTTCAACATAGGAATTTTGGGG - Intergenic
1049491794 8:142908071-142908093 ATTTCAACACAGAAATTTCTGGG + Intronic
1050778562 9:9300499-9300521 ATTTCAACACATGAATTTGGGGG - Intronic
1051475010 9:17496548-17496570 ATTTCAACATACAAATTTTGGGG + Intronic
1051508664 9:17852776-17852798 ATTTCAACACATGAGTTTGGGGG + Intergenic
1052100318 9:24438110-24438132 ATTTCAACATATGAATTTGGGGG + Intergenic
1052278725 9:26708141-26708163 ATTTCAACACATACATTTTGAGG + Intergenic
1052309370 9:27048895-27048917 ATTTCAACATAAAATTTGGAGGG - Intronic
1052344093 9:27390746-27390768 ATTTCAACATACAAATTTTGGGG - Intronic
1052523976 9:29588855-29588877 ATTTCAACACATAATTTGGATGG - Intergenic
1052671898 9:31568719-31568741 ATTTGAACATATAAATTTGGGGG - Intergenic
1052674671 9:31605052-31605074 ACTTCAACATATAAAATGGGAGG - Intergenic
1053424629 9:38003066-38003088 ATTTACACCCAGAAATTAGGAGG - Intronic
1054972062 9:71099363-71099385 ATTTCAACACATAAATTTTGGGG + Intronic
1055107524 9:72528033-72528055 ATTTCAACATATAAGTTTGGCGG - Intronic
1055167689 9:73217681-73217703 ATTTCAACATAGAAATTCTGAGG - Intergenic
1055221395 9:73936563-73936585 ATTTCCAGACAGAAAAGGGGTGG - Intergenic
1055722642 9:79192958-79192980 ATTGCAACACAGGAATTCGAGGG + Intergenic
1056219312 9:84435635-84435657 ATTTCAACATAGGAATTTGGGGG + Intergenic
1056222928 9:84467894-84467916 ATTTCAACATATGAATTTGGGGG - Intergenic
1056422166 9:86439093-86439115 ATTTCAACATAAGACTTGGGGGG - Intergenic
1056680265 9:88711343-88711365 GTTACACCACAGAAATTGGCAGG - Intergenic
1056693327 9:88826336-88826358 ATTTCAACATACAAATTTGGTGG - Intergenic
1056720122 9:89064210-89064232 ATTTTAACATATAAATTTGGGGG + Intronic
1056827847 9:89889208-89889230 ATTTCAACACAGGAATTTGTGGG - Intergenic
1056987194 9:91374124-91374146 ATTTCAACATAGGAATTTTGGGG + Intergenic
1057126677 9:92621198-92621220 ATTTCAACATATAAATTTGGGGG + Intronic
1057308945 9:93929519-93929541 ACTTCAATACACAAATTTGGGGG - Intergenic
1057522121 9:95768503-95768525 ATTTCAACACATGAATTTTGGGG - Intergenic
1057530037 9:95837099-95837121 ACTTCAACATAGGAATTTGGGGG + Intergenic
1057762749 9:97889845-97889867 ATTTCAACACATGAACTAGGGGG + Intergenic
1057816077 9:98296066-98296088 GTTTCAACACATGAATTTGGGGG - Intronic
1057974369 9:99588735-99588757 GTTTCAACACATGAATTTGGGGG - Intergenic
1058032255 9:100213184-100213206 ATTTCAACACATGAATTGGGGGG + Intronic
1058794823 9:108487974-108487996 ATTTCAACACATGGATTTGGGGG + Intergenic
1058939802 9:109802445-109802467 ATTTCAACACAGCAAATGTCTGG - Intronic
1059038166 9:110781843-110781865 ATTTCAACACATGAATGTGGGGG + Intronic
1059489448 9:114655101-114655123 ATTTCAACACATGAATTTGGGGG - Intergenic
1059564726 9:115372295-115372317 ATTTCAACATATGAATTTGGGGG + Intronic
1059627337 9:116081127-116081149 ACTTCAATACATAAATTTGGGGG + Intergenic
1059923366 9:119182464-119182486 ATTTCAACATACAAATTTGGGGG - Intronic
1059987436 9:119834446-119834468 ATTTCAACATACAAATTTTGGGG - Intergenic
1060231999 9:121832156-121832178 ATTTCAACATATAAATTTGGTGG + Intronic
1060473070 9:123964815-123964837 ATTTCAACACTGAGATTGAAGGG - Intergenic
1060707408 9:125816778-125816800 ATTTCAACACTGAAATTGCTTGG + Intronic
1061362579 9:130153065-130153087 ATTTCAACATAGGAATTTAGGGG + Intergenic
1061681321 9:132243768-132243790 ATTACAACACAGAAAAGGAGGGG + Exonic
1062150191 9:135014124-135014146 ACTTCAACATACAAATTTGGGGG - Intergenic
1062531190 9:137001181-137001203 GTTTCAACACACAAATTTTGGGG - Intergenic
1203491444 Un_GL000224v1:109135-109157 ATTTCAACATAGGAATTAGAGGG + Intergenic
1203504068 Un_KI270741v1:51005-51027 ATTTCAACATAGGAATTAGAGGG + Intergenic
1185728902 X:2445508-2445530 ATTTCAACGCAGGAATTTGGGGG - Intronic
1185729588 X:2450812-2450834 ATTTCAATGCAGGAATTTGGGGG - Intronic
1185731127 X:2462883-2462905 ATTTCAATGCAGGAATTTGGGGG - Intronic
1185876726 X:3708043-3708065 ATTTCAACACAGGAATTTTAGGG - Intronic
1185881574 X:3745834-3745856 ATTTCAACATAGGAATTTTGGGG + Intergenic
1185948279 X:4402004-4402026 ATTTCAACATATGAATTTGGAGG - Intergenic
1186057061 X:5661142-5661164 ATTTCAACATAGAAATTTGGGGG - Intergenic
1186103122 X:6177798-6177820 ATTTCAACATAGGAATTTGGAGG - Intronic
1186442776 X:9600445-9600467 GTTTCAACATAGGAATTTGGTGG + Intronic
1186449548 X:9660861-9660883 ATTTCAACATAGGAATTCGGGGG - Intronic
1186468818 X:9805400-9805422 ATTTCAACACCGGAATTTTGGGG - Intronic
1186482955 X:9910083-9910105 GTTTCAACATAGGAATTTGGGGG + Intronic
1186528166 X:10268608-10268630 GTTTCAACATATAAATTGTGGGG - Intergenic
1186890427 X:13954166-13954188 ATTTCAACATAGGAATTTTGGGG + Intergenic
1187021398 X:15386597-15386619 AAATCAACACAGAAAGGGGGAGG + Intronic
1187150761 X:16679597-16679619 ATTTCAACATAGGAATTTTGGGG - Intronic
1187186538 X:16992092-16992114 GTTTCAACATAGGAATTTGGGGG - Intronic
1187261705 X:17690682-17690704 ATTTCAATACAGTGATAGGGAGG + Intronic
1187280638 X:17856276-17856298 ATTTCAACACAGGAGTTTGGAGG - Intronic
1187768778 X:22672144-22672166 ATTTCAACATACAAATTTTGGGG - Intergenic
1187784158 X:22865945-22865967 ATTTCAACACATGAATTTAGGGG - Intergenic
1187946290 X:24429162-24429184 ATTTCAACACAAGATTTGGGTGG - Intergenic
1187956416 X:24523314-24523336 ATTTCAACATAGGAATTTGGGGG + Intronic
1188283127 X:28294979-28295001 ATTTCAACATGAATATTGGGGGG + Intergenic
1188294754 X:28433636-28433658 ATGTAAATGCAGAAATTGGGTGG - Intergenic
1188467129 X:30494264-30494286 ATTTCAACATAGGAATTTGGAGG + Intergenic
1188474504 X:30576544-30576566 ATTTCTAAATAAAAATTGGGAGG + Intronic
1188535377 X:31190902-31190924 TCTACAACACAGAAACTGGGAGG + Intronic
1188558855 X:31444763-31444785 ATTTCAACATAGGAATTTGAGGG - Intronic
1188847882 X:35096261-35096283 ACTTCAACATATAAATTTGGGGG - Intergenic
1188936762 X:36185366-36185388 ATTTCAACAAATGAATTGAGGGG + Intergenic
1188936816 X:36185958-36185980 ATTTTAACATATAAATTTGGGGG + Intergenic
1189158796 X:38788922-38788944 ATTTCAACATATGAATTTGGAGG - Intergenic
1189326055 X:40111762-40111784 ATATCTACAGAGAAACTGGGGGG - Intronic
1189555963 X:42145855-42145877 ATTTCAACATATTAATTGGGGGG - Intergenic
1189569734 X:42283799-42283821 ATTTCAACACATGAATTTTGGGG - Intergenic
1189636867 X:43020358-43020380 GTTTCAACATATAAATTTGGTGG - Intergenic
1189793938 X:44629525-44629547 ATTTCAACATATAAATTTTGGGG - Intergenic
1189850922 X:45175550-45175572 ATTTAAACACAAAAAATAGGTGG - Intronic
1190463530 X:50703234-50703256 ATGTCAAGACAAAAATTGGCTGG - Intronic
1190838815 X:54127193-54127215 ATTTCAACATAAGAATTGCGGGG + Intronic
1190959308 X:55229434-55229456 ATTTCAACATATGAATTCGGTGG - Intronic
1191926430 X:66315843-66315865 AATTCAAGACAAAATTTGGGTGG - Intergenic
1192392106 X:70740505-70740527 ATTTCAACATAGGAATTTGCGGG + Intronic
1192395641 X:70778381-70778403 ATTTCAACATAGGAATTGTGGGG - Intronic
1192418299 X:71004576-71004598 ATTTCAAAAAAGCAAATGGGAGG - Intergenic
1192626095 X:72730408-72730430 ATTTCAACCCAAGAATTGGAGGG - Intergenic
1193008458 X:76647528-76647550 AATTCAACACAAGATTTGGGTGG - Intergenic
1193231509 X:79052288-79052310 ATTTCAACATATAAATTTGAAGG + Intergenic
1193256051 X:79350486-79350508 ATTTCAACACATGAATTTTGGGG - Intergenic
1193543367 X:82797769-82797791 ATTTCAACATATAAATTTAGTGG - Intergenic
1193553341 X:82925835-82925857 GTTTCAACACATAGATTTGGGGG + Intergenic
1194315330 X:92369602-92369624 GTTTCAAGCCAAAAATTGGGTGG - Intronic
1194498404 X:94648068-94648090 GATTCAACACATAAATTTGGGGG + Intergenic
1195089268 X:101442815-101442837 ATTTCAACACAAATTTTGGAGGG - Intronic
1195612800 X:106888014-106888036 ACTTCAACATATAAATTTGGAGG - Intronic
1195977631 X:110544639-110544661 TTTTCAACACAAGAATTGGGAGG - Intergenic
1196005163 X:110829026-110829048 ATTTCAACATATTAATTTGGGGG + Intergenic
1196021570 X:110996476-110996498 ATGTCAACACAATAATTTGGTGG - Intronic
1196021703 X:110997725-110997747 ATTTCAACATAGAAATTTTGGGG - Intronic
1196255356 X:113511843-113511865 GTTTCAACATATGAATTGGGAGG - Intergenic
1196671245 X:118370272-118370294 ATTTCAACATAAGAATTGGAGGG - Intronic
1196930195 X:120674403-120674425 AGTTCAATACATAAATTTGGTGG + Intergenic
1196974831 X:121147967-121147989 ATTTCAAAACATAAATTTTGAGG - Intergenic
1197089700 X:122521912-122521934 ATTTCAACAAAAAAATTATGAGG + Intergenic
1197711701 X:129676186-129676208 ATTTCAACATATGAATTTGGGGG + Intergenic
1197721139 X:129745457-129745479 ATTTCTACACAGAAAGTGGCTGG - Intronic
1197842315 X:130761853-130761875 ATTTCAACACAAGATTTGAGTGG + Intronic
1197914158 X:131516720-131516742 CTTTCAACACATGAATTTGGAGG - Intergenic
1198174602 X:134142934-134142956 ATTTTAACACATGAATTTGGGGG + Intergenic
1198246474 X:134836743-134836765 ACTTCAACACAGGAATTTGAGGG + Intronic
1198463234 X:136882791-136882813 ATTTCAACATATGAATTTGGGGG - Intergenic
1198823776 X:140677449-140677471 TTATCAACACAGAAATTTGATGG - Intergenic
1199211392 X:145215663-145215685 ATTTCAACATAGGAATTTTGAGG - Intergenic
1199522525 X:148752142-148752164 ATTTCAACATATGAATTTGGGGG + Intronic
1199652499 X:149960350-149960372 ATTTCAACATATAAATTTTGCGG + Intergenic
1199742442 X:150748211-150748233 ATTTCAACATAGAAATTTTGGGG + Intronic
1199762400 X:150915241-150915263 GTTTCAACATAGGAATTTGGTGG - Intergenic
1199775817 X:151010937-151010959 ACTTCAACATATAAATTTGGGGG - Intergenic
1199814221 X:151383511-151383533 TTTGCAACACAGCAATTGAGGGG + Intergenic
1199814226 X:151383579-151383601 ATTTCAACATAGGAATTTGAGGG - Intergenic
1200007006 X:153093286-153093308 ATTTTAACATATGAATTGGGAGG + Intergenic
1200016406 X:153167370-153167392 TTTTTAAAATAGAAATTGGGAGG + Intergenic
1200180894 X:154150119-154150141 ATTTCAACACAGAAATTTATGGG + Intronic
1200186537 X:154187233-154187255 ATTTCAACACAGAAATTTATGGG + Intergenic
1200192189 X:154224371-154224393 ATTTCAACACAGAAATTTATGGG + Intronic
1200197944 X:154262175-154262197 ATTTCAACACAGAAATTTATGGG + Intronic
1200284850 X:154810738-154810760 GTTTCAACATAGGAATTTGGGGG + Intronic
1200320335 X:155181780-155181802 ATTTCAACATATGAATTTGGGGG + Intergenic
1200623379 Y:5481137-5481159 GTTTCAAGCCAAAAATTGGGTGG - Intronic
1200662423 Y:5975765-5975787 ATGGCAACACAGTAATTGTGGGG + Intergenic
1200783462 Y:7237905-7237927 ATTTCAACATAGGAATTTTGTGG - Intergenic
1200788638 Y:7280367-7280389 ATTTCAACACAGGAATTTTAGGG + Intergenic
1201378786 Y:13349894-13349916 GTTTCAAAATAGGAATTGGGCGG - Intronic
1201626287 Y:16018269-16018291 CTTTCAACACAGGAATTAAGTGG + Intergenic
1201992851 Y:20047658-20047680 TTTTCAATACAAAAATTGTGAGG + Intergenic