ID: 1088930280

View in Genome Browser
Species Human (GRCh38)
Location 11:114344340-114344362
Sequence CTTTGGAAGGGCAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088930271_1088930280 11 Left 1088930271 11:114344306-114344328 CCAGGTGCAATGATTCATGACTG No data
Right 1088930280 11:114344340-114344362 CTTTGGAAGGGCAAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088930280 Original CRISPR CTTTGGAAGGGCAAGGTGGG AGG Intergenic
No off target data available for this crispr