ID: 1088930545

View in Genome Browser
Species Human (GRCh38)
Location 11:114347155-114347177
Sequence CTGGACTCCTTGGGTCAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088930545_1088930552 17 Left 1088930545 11:114347155-114347177 CCCTATTGACCCAAGGAGTCCAG No data
Right 1088930552 11:114347195-114347217 TCCCTCAGTCCCCTCTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088930545 Original CRISPR CTGGACTCCTTGGGTCAATA GGG (reversed) Intergenic
No off target data available for this crispr