ID: 1088940751

View in Genome Browser
Species Human (GRCh38)
Location 11:114453454-114453476
Sequence CCTCCTGAGGAGTGGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088940751_1088940759 17 Left 1088940751 11:114453454-114453476 CCTTCCAACCACTCCTCAGGAGG 0: 1
1: 0
2: 2
3: 19
4: 186
Right 1088940759 11:114453494-114453516 ATTTTTTTTCCCCCAAGCCCTGG 0: 1
1: 0
2: 13
3: 80
4: 533
1088940751_1088940758 -9 Left 1088940751 11:114453454-114453476 CCTTCCAACCACTCCTCAGGAGG 0: 1
1: 0
2: 2
3: 19
4: 186
Right 1088940758 11:114453468-114453490 CTCAGGAGGCTGGGCTATCAAGG 0: 1
1: 1
2: 0
3: 21
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088940751 Original CRISPR CCTCCTGAGGAGTGGTTGGA AGG (reversed) Intergenic
900340381 1:2185992-2186014 TCACCTGAGGGGTGGGTGGACGG - Intronic
900640182 1:3684755-3684777 TCTCCTGAGCAGGGGTGGGAGGG - Intronic
901837341 1:11933036-11933058 GCTCCAGAGGAGTGGGTGGCAGG - Intergenic
903029353 1:20451878-20451900 CCTGCTGAGGGGTTGCTGGAGGG - Intergenic
904486245 1:30826112-30826134 CCTGCTGAGGGGTGATAGGAAGG - Intergenic
904576847 1:31510333-31510355 TCTCTTGAGCAGTGGTTGAAGGG + Intergenic
904725092 1:32540604-32540626 CCTCCAGAGGAGTCTTTAGAAGG + Intronic
905195457 1:36273258-36273280 CGTCCTGAGGCCTGGTTAGAGGG + Intronic
906078772 1:43070057-43070079 CCATCTGGGGAGTGGTGGGAGGG - Intergenic
907254387 1:53167500-53167522 CCTAATGGGCAGTGGTTGGAAGG - Intergenic
907562206 1:55401425-55401447 TCTCCTGAGGAGTGATTTCAGGG + Intergenic
916577488 1:166080789-166080811 CCTCCTGTGGAGGGGTTGGGAGG - Intronic
917458294 1:175204771-175204793 CCTCCTGAGGAGCTGCTGGATGG - Intergenic
918263499 1:182818543-182818565 CGTGCTGAGGAGTTGTTGGATGG + Exonic
919393988 1:197022259-197022281 CTTCCTGGGGACTGGTTGAATGG + Intergenic
919448383 1:197738926-197738948 CTTCCTGAGATGAGGTTGGAAGG + Intronic
920291854 1:204929106-204929128 CCTCCTGGGGATGGGGTGGAGGG - Intronic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
921184184 1:212655937-212655959 CCTGGTGAGGAGAGGTGGGATGG + Intergenic
921549667 1:216519365-216519387 CCTTCTGCAGAGTGCTTGGATGG - Exonic
922442508 1:225667657-225667679 CCTCCTGACCAGTGTTTGGGTGG - Intergenic
922536655 1:226386027-226386049 CCTCCTGAGGGGTGGCATGATGG - Intronic
923281028 1:232443041-232443063 GCTCCTGAGGAGTGGTCTGCTGG - Intronic
923316511 1:232785658-232785680 CCTCTTGTGGGGTGGGTGGAGGG - Intergenic
924259376 1:242213793-242213815 CCTCCAGGGGAGTGTTTGGTGGG - Intronic
1063202407 10:3796601-3796623 CTTCCTGAGGAATGTGTGGAAGG + Intergenic
1063476776 10:6335690-6335712 CCACCTGAGCACTGGATGGAAGG + Intergenic
1064996256 10:21299452-21299474 CCTACTGGGGAGTGGGTTGAAGG - Intergenic
1065494501 10:26314849-26314871 CCTCCTGAGCACTGGCTGCAGGG - Intergenic
1065844502 10:29734511-29734533 CCTCCTGGGAAGAGGTTGTAAGG + Intronic
1067065506 10:43101990-43102012 CCTCCTGAGGAGGGTGTGGCAGG + Intronic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1069304546 10:66952343-66952365 CCTCCTGATGAGCTGTTGAAAGG - Intronic
1074461335 10:113640157-113640179 CTTCCTGAGGAGTGATTTGTAGG - Intronic
1074717084 10:116229577-116229599 GCTCCTAAGGAGGGGTGGGAAGG - Intronic
1075301119 10:121325014-121325036 CCTGCTGAGGAGTGTTTGCCAGG - Intergenic
1075825051 10:125348886-125348908 CCTCCTGAGAAGTGTAAGGAAGG + Intergenic
1076178600 10:128387798-128387820 CCTCCTGAGGAGTTGGGGTAGGG + Intergenic
1076323688 10:129603936-129603958 CCTCCTGAGCAGTGGAGGGCTGG + Intronic
1076778886 10:132713293-132713315 CATCCTGAGGAAGGGGTGGAAGG + Intronic
1076998918 11:312521-312543 CCTGTTGAGGGGTGGGTGGAGGG + Intronic
1077526337 11:3067903-3067925 CCTTCTGGGGAGGGGTAGGATGG + Intergenic
1077921892 11:6647468-6647490 CCTCCTGAGGACTGGTTCCCAGG + Intronic
1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG + Intronic
1080260276 11:30342382-30342404 CCTCTTGATGGGTGGGTGGATGG + Intergenic
1081585825 11:44382921-44382943 CCTCCAGAGGACTTGGTGGAGGG - Intergenic
1083794084 11:65004544-65004566 CTTCCTGACGGGTGGTGGGAAGG - Intergenic
1088231391 11:107676943-107676965 CCTCTTGAAGAATGGTTGGAAGG + Intergenic
1088460980 11:110082632-110082654 CCTCATGAGGCGTGGTTGTAAGG - Intergenic
1088940751 11:114453454-114453476 CCTCCTGAGGAGTGGTTGGAAGG - Intergenic
1089065119 11:115656766-115656788 CCTCCTGAGCAGTGGCAGCAGGG + Intergenic
1091272675 11:134328845-134328867 TCTCCTGAGGGGAGGGTGGATGG + Intergenic
1095086989 12:38067393-38067415 CCTGCTGTGGGGTGGTGGGAGGG + Intergenic
1097865847 12:64558693-64558715 CTTTCTGAGGAGTGGCTGTAAGG + Intergenic
1101238887 12:102818270-102818292 CCTACTGAGGAGAGGATAGAGGG - Intergenic
1101592822 12:106138997-106139019 CCTCCCGGGGAGGGGTTGGGGGG - Exonic
1103506102 12:121443120-121443142 TCTCCAGAGGAGGGGCTGGAGGG + Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105960491 13:25330824-25330846 GCACCTCAGCAGTGGTTGGAGGG - Intronic
1107671218 13:42748248-42748270 CATACTTAGGAGTGGTGGGATGG - Intergenic
1108284862 13:48896693-48896715 TCTGATGAGGAGTGGTAGGAAGG + Intergenic
1110789422 13:79570655-79570677 CCTCATGATGAGAGATTGGAAGG + Intergenic
1112160292 13:96860018-96860040 CCCTAGGAGGAGTGGTTGGATGG - Intergenic
1117032145 14:51683924-51683946 CCACCAGAGCAATGGTTGGAAGG + Intronic
1117244525 14:53870941-53870963 CCTCCTGAGGGGTGGTTTAGAGG - Intergenic
1122128157 14:99590315-99590337 CCTCCTGCTGACAGGTTGGACGG - Intronic
1128997506 15:72307526-72307548 TCCCTTGAAGAGTGGTTGGAAGG - Intronic
1129266572 15:74396552-74396574 CCTCCTGAGGCCTGGCTGGCAGG + Intergenic
1129921530 15:79323164-79323186 CATCTTGAAGAGTGGTTGGGAGG - Intronic
1130573389 15:85069315-85069337 GGTCCTGAGGAGAGGCTGGATGG - Intronic
1130972039 15:88741279-88741301 CCCCCTCAGGAGTGAGTGGATGG + Intergenic
1134531657 16:14988843-14988865 CCTCCAGAAGAGTGGCTGCAAGG - Intronic
1137946815 16:52740972-52740994 ACTCCTGAGGATTGGTTGCTAGG + Intergenic
1138110180 16:54317607-54317629 CCAGCTGGGGAGCGGTTGGAGGG + Intergenic
1139580262 16:67869010-67869032 CAGCCTGAGGAGTGGTAGCAAGG - Intronic
1139599809 16:67979883-67979905 CCTCCTGAGGTTGGGTTGGAGGG + Intronic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1142961571 17:3555140-3555162 CCACCTGGGGACTGGTTGGCTGG - Intronic
1147260708 17:39208528-39208550 CCTGCTGAGGAGTGCAAGGAAGG - Intergenic
1147375695 17:40021483-40021505 CCTCCAGGGAAGTGGTTGGTGGG + Intronic
1147393093 17:40122151-40122173 CCTCCTCAGGAGGGGGTGGAGGG - Intergenic
1148618375 17:49016490-49016512 CCTCCAGAGGAGTGGGAAGAAGG + Intronic
1148787468 17:50152294-50152316 CCTGCAGTGGAGTGGTAGGAGGG - Intergenic
1149889133 17:60370638-60370660 CCTCCTCCTGAGTGGTTGGGTGG - Intronic
1150479592 17:65499184-65499206 CCTCCTGAGGGTTGGGAGGAGGG - Intergenic
1151930304 17:77227958-77227980 CCTCCTGTGGCATGGCTGGAAGG + Intergenic
1152670284 17:81600045-81600067 CCTCATGAAGTGTGGCTGGAAGG + Intronic
1156361462 18:36387910-36387932 TCTCTTGTGGAGAGGTTGGAGGG + Intronic
1157203665 18:45680533-45680555 TCTTCTGAGGAGAGCTTGGATGG - Intronic
1157559520 18:48636763-48636785 GCTCCTGAGGAGTGGTGACATGG + Intronic
1158638249 18:59180031-59180053 CCTCCAGAGGAAAGGCTGGAAGG - Intergenic
1160152538 18:76406109-76406131 CCTCCGGAGGAGGGGCTGCAGGG - Intronic
1161341527 19:3745787-3745809 CCTCCTGAGGAGTGGGTGGCTGG - Intronic
1163104378 19:15115112-15115134 CTCCCTGAGGAGGGGATGGAGGG - Exonic
1163784850 19:19269766-19269788 CTTCCTGAGCAGGGGATGGAGGG + Exonic
1164704644 19:30311262-30311284 CCTACTGAGGACTGGTTATAAGG + Intronic
1164827044 19:31291401-31291423 CCTCATGAAGAGTGCTGGGAAGG - Intronic
1165325977 19:35115001-35115023 CCGCCTTAAGAGTGGTAGGAGGG + Intergenic
925001584 2:407071-407093 GCTCCTGGGGTGTGGCTGGAAGG + Intergenic
925161535 2:1687412-1687434 CGTCCTGAGGGGTGGGTGGAGGG + Intronic
925411671 2:3643246-3643268 CCTCCACAGGAGTGGAGGGAGGG - Intronic
925756675 2:7139395-7139417 CCACCTGTGGAGGGGGTGGAGGG + Intergenic
925883094 2:8369392-8369414 CCTGTTGTGGGGTGGTTGGAGGG - Intergenic
927249292 2:20983374-20983396 CCTCCTGGACAGTGTTTGGAAGG - Intergenic
927499762 2:23574939-23574961 ACTCCTGAGGAATGGGTGGGAGG + Intronic
929335349 2:40736981-40737003 GATGATGAGGAGTGGTTGGAGGG - Intergenic
931746165 2:65293659-65293681 CCTCCTGAGGCCTGGTTTGGAGG - Intergenic
933255070 2:80071570-80071592 CCACTTGATGTGTGGTTGGAGGG + Intronic
935717995 2:105955357-105955379 CCTCCTGTGCTGTGGGTGGAAGG - Intergenic
938472228 2:131575472-131575494 CCACCTGAGGCGTGGATGCAAGG - Intergenic
939630465 2:144522426-144522448 CTTCCTTAGGAGTGGTGGAAGGG - Intronic
940594260 2:155769399-155769421 CCTTCTGAGGTGAGGTAGGAAGG + Intergenic
942325711 2:174775697-174775719 CATCCTGAGAAGTGTTGGGACGG + Intergenic
945435405 2:209811501-209811523 ACTGATGAGAAGTGGTTGGAAGG + Intronic
948267625 2:236647110-236647132 CATCCTGATGGGTGGGTGGAGGG - Intergenic
1168753725 20:301285-301307 CCTCCTGGAGAGTGGGGGGATGG - Intergenic
1172199325 20:33114100-33114122 CCTCCTGAGGAAAGGGTGGGAGG - Intergenic
1173751545 20:45480493-45480515 CCTCCTGAGTAGCGGGTGGGTGG - Intronic
1173918637 20:46727677-46727699 CATTCTGAGGTGTGGTGGGATGG + Intronic
1174600955 20:51724423-51724445 CCTCCTGAGGAGTGATGGGAAGG - Intronic
1174863957 20:54117687-54117709 CCTCCTGAGGATTGAATGAATGG + Intergenic
1175322755 20:58100950-58100972 AGTCATGAGGAGTGGTTGGGAGG + Intergenic
1175520033 20:59596727-59596749 CCTGCTGAGCAGAGCTTGGAAGG - Intronic
1176052775 20:63129286-63129308 CCTCCTGAGGAGCAGGTGGACGG - Intergenic
1176107191 20:63395002-63395024 CCTCATGAGGAGTGGTCGCTTGG - Intergenic
1176141273 20:63546195-63546217 TGTCCTGAGCAGTGGTTGGGGGG - Intronic
1176893209 21:14344453-14344475 GCTCCTGAGAAGTGGTTGATGGG - Intergenic
1177859755 21:26438838-26438860 CCCCGTCAGGAGTGGGTGGAGGG + Intergenic
1182481472 22:30611917-30611939 CCTCTTGAGAAGTGGATGCAGGG + Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183922054 22:41177429-41177451 CAGTCTGAGGAGGGGTTGGAGGG - Exonic
1184339459 22:43878238-43878260 GTCCCTGAGGAGTGGTTGTAAGG + Intergenic
1184843028 22:47063590-47063612 CCTCCTCAGGTGTGACTGGAGGG - Intronic
950299930 3:11868007-11868029 TCTCATGGGGACTGGTTGGACGG - Intergenic
950667797 3:14507697-14507719 AGTCCTGAGGAGTGGATGCAGGG + Exonic
954285744 3:49617706-49617728 CCTCCTGAGGAGGCCTTGGACGG + Intronic
954670792 3:52290386-52290408 CCGCCAGAGGAGTGGATGCAAGG - Exonic
954793471 3:53149330-53149352 CCTCCTGAGGGGAGGAGGGAAGG - Intergenic
954808001 3:53231425-53231447 CCTCCTGTGGAGGGGTTGCCAGG + Exonic
955971514 3:64442817-64442839 CCTCCTGAGCAGTGGTTGAGGGG + Intronic
956048073 3:65217822-65217844 CCTGTTGTGGAGTGGGTGGAAGG - Intergenic
961219756 3:125190377-125190399 CTTCCTGAGGACTGGCTGGCTGG - Exonic
963275116 3:143322018-143322040 TCTCCTGAGAAGTCATTGGAAGG - Intronic
966810336 3:183838135-183838157 CCTACTCAGGAGAGGTGGGAGGG - Intronic
968384033 4:120861-120883 CCGTCTGAGGAGTGGTGGAACGG - Intergenic
968861260 4:3172561-3172583 CCTCCTGGGGAGTGAAGGGAAGG - Intronic
968939594 4:3631053-3631075 CCTCCTGGGGTGGGGTGGGAGGG + Intergenic
969631383 4:8340698-8340720 CCTCCTGAGGTGTAGATGGGAGG - Intergenic
969721848 4:8896403-8896425 CCTCCTGAGGTCAGGCTGGAGGG - Intergenic
969932135 4:10641153-10641175 CCTCCTGAGGGACAGTTGGAGGG + Intronic
972633164 4:40859255-40859277 CCTCCTGATGAGATGTTGGCTGG - Intronic
973783991 4:54318099-54318121 CGGACTGAGGACTGGTTGGAAGG + Intergenic
974523815 4:63021207-63021229 CATCCTGAGGTGTTGTTGGTTGG + Intergenic
975235235 4:71987090-71987112 CCTCTTGTGGGGTGGGTGGAGGG + Intergenic
976312644 4:83627636-83627658 CCTCAAGAGGAGTGGTGGGTAGG + Intergenic
979446308 4:120816434-120816456 ACTGGTGAGGAGTCGTTGGAGGG - Exonic
980917199 4:139044783-139044805 TCTACTGAGGAGTGGCTGGAAGG - Exonic
985641033 5:1063645-1063667 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
985641050 5:1063694-1063716 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
985641067 5:1063743-1063765 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
990333067 5:54746211-54746233 CTTGCTGAGGAGTGGATGGGTGG + Intergenic
1002260808 5:177992842-177992864 CCTCCTGTGGAGGGCTGGGAAGG + Exonic
1002873628 6:1190562-1190584 CCTCATCAGGAGTGGATGAAAGG - Intergenic
1003132462 6:3406718-3406740 CTTCCTAAGGAGTGTTTGCATGG - Intronic
1005965692 6:30724961-30724983 CCTCCAGAGTAGAGCTTGGAGGG - Exonic
1006840084 6:37022873-37022895 CCTCCTGAGGTGTGCTGTGAGGG - Intronic
1011642984 6:89432958-89432980 CCTTCTGAAGAGTGGGAGGAAGG - Intergenic
1011868140 6:91857781-91857803 CCTCATGAGGAGTCATAGGAGGG - Intergenic
1014116425 6:117673257-117673279 CCTCCTAAAGAGTGGTGGGGCGG - Intergenic
1014832118 6:126115124-126115146 CCTCCTGAAGGGTGGCTGGAAGG - Intergenic
1015255035 6:131169587-131169609 CCTCCAGGGGACTGGGTGGAGGG - Intronic
1015499869 6:133920901-133920923 CCACCTGAGGAGACGATGGATGG + Intergenic
1015521552 6:134136521-134136543 CCTGCTGTGGAGTGGGGGGAGGG - Intergenic
1017019733 6:150130573-150130595 GCTCCTGAGGAGAGGCTGCATGG + Intergenic
1017871747 6:158492700-158492722 GCTCCTGAGGAGTGGGAGGATGG - Intronic
1018171959 6:161150712-161150734 CCTCCTGAGGAGTAGCTGCCTGG + Intronic
1018865668 6:167745458-167745480 CCACATGGGGAGTGGTTGGCTGG - Intergenic
1021374862 7:19894035-19894057 CCTGCTGAGGAGTGGGGGGCTGG + Intergenic
1026903871 7:74051687-74051709 CCTCCTGAGGACAGGCAGGATGG - Intronic
1027433155 7:78135021-78135043 CCTCCTGAGGAATGATGCGAAGG + Exonic
1028884020 7:95911514-95911536 CCTCCTGAGAAGTGGCTGATTGG + Intronic
1029192003 7:98778536-98778558 CCTCCTGAGGCGTGGGTTGATGG - Intergenic
1029530318 7:101121231-101121253 CCTCCTGAGGAGTTGCTAGTTGG - Intergenic
1030005254 7:105112271-105112293 CCTGCTGAGTATTGGCTGGAAGG - Exonic
1031063223 7:117075514-117075536 CATCCAGAGGAGTGGATGGCAGG - Intronic
1032948887 7:136884677-136884699 CCTCCTGGGGAATGTTGGGAAGG + Intronic
1039545649 8:38409192-38409214 TCCCCTGGGGAGTGGTTAGAAGG + Intronic
1041967452 8:63696188-63696210 CCACCTTAGGAGGGGTTGGTGGG + Intergenic
1046769914 8:118108723-118108745 CCTCTATAGGAGTGATTGGAAGG - Intronic
1046796511 8:118379526-118379548 CTTCCTGATGGGTGGATGGATGG - Exonic
1048314573 8:133352565-133352587 CCTGCTGACAAGTGGATGGATGG + Intergenic
1048528920 8:135229662-135229684 GCTGCTGAGGAGAGATTGGAAGG + Intergenic
1049015414 8:139916503-139916525 CGTTCCGAGGAGTGGATGGAGGG - Intronic
1049323121 8:142007843-142007865 CTTCCTCAGGGGTGGGTGGACGG - Intergenic
1051031454 9:12684989-12685011 CCTCCGGAGGAGGACTTGGAAGG - Intergenic
1054451178 9:65404279-65404301 CCTCCTGGGGTGGGGTGGGAGGG - Intergenic
1055351451 9:75393224-75393246 TCTCCTGAGGAGTGGTGTGATGG - Intergenic
1055741578 9:79395432-79395454 CCTCCTAAGCAGTGTTGGGATGG - Intergenic
1056908879 9:90679823-90679845 TCTCCTGAGGAGTTTTTGGAGGG + Intergenic
1062307006 9:135913291-135913313 CCTTCTGGGGAGGAGTTGGATGG + Intergenic
1187665457 X:21604309-21604331 CCTGCTGTGGAGTGGGGGGAGGG + Intronic
1190683632 X:52851390-52851412 CCTCATGGGTAGTGGATGGAGGG + Intergenic
1190999537 X:55645857-55645879 CCTCATGGGTAGTGGATGGAGGG + Intergenic
1193551106 X:82893697-82893719 TCTGCTGAGGATTGGTTGGGTGG - Intergenic
1197723858 X:129762607-129762629 CCTACTGATGAGTGGCTGGAGGG - Intronic
1199995416 X:153021688-153021710 CCTGCTGAAGAGTGGATAGAGGG - Intergenic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1202058259 Y:20858248-20858270 TCTCCAGAGGAGTGTGTGGATGG - Intergenic