ID: 1088944582

View in Genome Browser
Species Human (GRCh38)
Location 11:114496313-114496335
Sequence AGGGAGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088944582_1088944594 29 Left 1088944582 11:114496313-114496335 CCCACAATCACTGTGCTCTCCCT No data
Right 1088944594 11:114496365-114496387 CATGCCACTGCTGCTGGGGAAGG No data
1088944582_1088944592 25 Left 1088944582 11:114496313-114496335 CCCACAATCACTGTGCTCTCCCT No data
Right 1088944592 11:114496361-114496383 ATGCCATGCCACTGCTGCTGGGG No data
1088944582_1088944595 30 Left 1088944582 11:114496313-114496335 CCCACAATCACTGTGCTCTCCCT No data
Right 1088944595 11:114496366-114496388 ATGCCACTGCTGCTGGGGAAGGG No data
1088944582_1088944591 24 Left 1088944582 11:114496313-114496335 CCCACAATCACTGTGCTCTCCCT No data
Right 1088944591 11:114496360-114496382 TATGCCATGCCACTGCTGCTGGG No data
1088944582_1088944590 23 Left 1088944582 11:114496313-114496335 CCCACAATCACTGTGCTCTCCCT No data
Right 1088944590 11:114496359-114496381 CTATGCCATGCCACTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088944582 Original CRISPR AGGGAGAGCACAGTGATTGT GGG (reversed) Intergenic