ID: 1088951866

View in Genome Browser
Species Human (GRCh38)
Location 11:114579796-114579818
Sequence TAGAACCAGCAAAATGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088951866_1088951868 13 Left 1088951866 11:114579796-114579818 CCTTAATCATTTTGCTGGTTCTA 0: 1
1: 0
2: 0
3: 20
4: 260
Right 1088951868 11:114579832-114579854 TTAATATCTTACATTATCTTTGG 0: 1
1: 0
2: 3
3: 59
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088951866 Original CRISPR TAGAACCAGCAAAATGATTA AGG (reversed) Intronic
900572716 1:3366705-3366727 TCGGAGCAGAAAAATGATTAGGG + Intronic
902217999 1:14946740-14946762 TAAATGCAGCAAAATGAGTAAGG - Intronic
903253870 1:22078314-22078336 AAGAACTAGCACAATTATTATGG - Intronic
903656779 1:24954321-24954343 TAGAACCAGTAAGAACATTAGGG - Intronic
904096819 1:27985489-27985511 AAGAACCAGCAAAATGTGTCAGG - Intronic
908188710 1:61678006-61678028 TAAAACTTGAAAAATGATTAAGG - Intergenic
909680789 1:78289049-78289071 TAGAATCAGCAAAATGTTAGAGG + Intergenic
909830776 1:80186910-80186932 TAGAACTAAAAAAATGCTTATGG + Intergenic
910239576 1:85072057-85072079 TATTAGCAGCAAAATGATTATGG + Intronic
910285776 1:85552577-85552599 TGGAACCAGCAAGATGATATGGG - Intronic
910292673 1:85614664-85614686 TAGATCTAGCAACTTGATTAAGG + Intergenic
910373169 1:86540204-86540226 TAGAATTAGAAAAATGAGTATGG + Intergenic
910571001 1:88702477-88702499 TAGAACCAGCAAATATATCAAGG - Intronic
911679741 1:100701641-100701663 TATAACCATCAAAAAGATGAGGG - Intergenic
911737046 1:101349009-101349031 CAAGACTAGCAAAATGATTAGGG - Intergenic
912846181 1:113076727-113076749 TGTGACCATCAAAATGATTATGG + Intronic
913096387 1:115521083-115521105 TAGAATAAGGAAAATGAGTAAGG - Intergenic
915517590 1:156422063-156422085 TAGAACCTACAAAATGAGTGAGG - Intronic
916158049 1:161877777-161877799 TAGCTCCGGCAAAATGATGATGG + Intronic
918132519 1:181642255-181642277 TAGAATCTGCAAGATGATAAAGG + Intronic
918879625 1:190099951-190099973 TAAAACCAGTAAAATAATGAGGG + Intronic
919375390 1:196787098-196787120 TAGAAACCGCATAATAATTATGG + Intronic
920874464 1:209821387-209821409 AAGAACCAGCAAGGTGACTAAGG - Intergenic
921637256 1:217511338-217511360 AAGAACCAGCAAAATAACCAGGG + Intronic
921721302 1:218474803-218474825 TTGGAGCAGCAAAATGATTAAGG + Intergenic
921800973 1:219401766-219401788 TAGGACTAGCAAAATTATTTTGG - Intergenic
1063653326 10:7962199-7962221 TAGAATCTGATAAATGATTAGGG - Intronic
1064593582 10:16920380-16920402 TAAAGCCAACCAAATGATTATGG + Intronic
1064684912 10:17850574-17850596 GAGAAACAGCATAATGATAATGG + Intronic
1065147400 10:22783476-22783498 TAGAATAAGCAAAATAATTTTGG - Intergenic
1066423913 10:35287536-35287558 TAGAACAGGCAAAATTAATACGG - Intronic
1066679700 10:37925405-37925427 TAGAACAAGGAAAATTATCAGGG + Intergenic
1067010508 10:42708235-42708257 TAAAGCCAACCAAATGATTATGG + Intergenic
1067313239 10:45135338-45135360 TAAAACCAACCAAATGATTATGG - Intergenic
1071670324 10:87603092-87603114 AATAACCACCAAAATGATAAAGG - Intergenic
1073976486 10:109107729-109107751 AAGAACCAGCAAAATGGATTAGG + Intergenic
1075155776 10:119974797-119974819 GAGAGCCAGCAAACAGATTAGGG + Intergenic
1075300499 10:121318731-121318753 CAAAATCAGGAAAATGATTAGGG - Intergenic
1075792055 10:125091905-125091927 TAGAACCATAAAAATAATCATGG - Intronic
1076514343 10:131034799-131034821 TAGAACATGCAAATTGTTTATGG - Intergenic
1076553125 10:131299419-131299441 TATAACTAGTAAAATAATTATGG - Intronic
1080298963 11:30762793-30762815 TAGAACCAGCAAATGTCTTAAGG + Intergenic
1081340302 11:41919371-41919393 TAGAAGAAGAAAAATGATTTAGG - Intergenic
1082149322 11:48714280-48714302 TAGAATCAGCAAAAGGAATTTGG - Intergenic
1082598508 11:55116251-55116273 TAGAATCAGCAAAAGGAATTTGG - Intergenic
1082665584 11:55971752-55971774 TAGAGCCAGTAATGTGATTATGG - Intergenic
1082910462 11:58367879-58367901 GAGAATAAGCAAAATGATGAAGG - Intergenic
1086864293 11:91960658-91960680 AAGAACCAGCAAAATAATTCTGG + Intergenic
1086990692 11:93300525-93300547 GAGAAAGAGCAAAACGATTATGG + Intergenic
1087359635 11:97142027-97142049 TAGAACATGGAAAATTATTAGGG - Intergenic
1087760991 11:102104265-102104287 TAGAAGCAGGAACATGATTTTGG + Intergenic
1088638904 11:111852069-111852091 TAGAACCAACAGATTGAATAAGG - Intronic
1088902575 11:114129188-114129210 TACAGCCAGAAAAATGCTTATGG - Intronic
1088951866 11:114579796-114579818 TAGAACCAGCAAAATGATTAAGG - Intronic
1089217633 11:116844809-116844831 TAAAACCAGCAGGATGATAAAGG + Intronic
1089423293 11:118348400-118348422 CAGAACCAGCTAAATGAAAAGGG + Intronic
1090852709 11:130584519-130584541 TAGACCAAGCAGAATGATTCTGG + Intergenic
1092513517 12:9184049-9184071 TAAAACCAGAAAAAAAATTATGG + Intronic
1092755255 12:11757336-11757358 TAGAACCAGCATAGTGAGAAGGG + Intronic
1092996443 12:13955452-13955474 TAGAGCCAACATAATGATTTAGG - Intronic
1093158769 12:15719952-15719974 TATAGCCAGGAAAATAATTAAGG - Intronic
1093842842 12:23926046-23926068 TGGAACTATCAAATTGATTATGG - Intronic
1095204179 12:39420543-39420565 CAGAAACAGCAAAGTGAGTATGG + Intronic
1096827322 12:54289731-54289753 TAAAAGCAGCACAGTGATTAGGG - Intergenic
1097512718 12:60564405-60564427 AAGAACCAGCAAAAGAATTCTGG - Intergenic
1097679940 12:62639505-62639527 TAAAACAAGATAAATGATTATGG + Intergenic
1099163766 12:79276110-79276132 AAGAACCAGAAAAATGATTCTGG + Intronic
1099880354 12:88459970-88459992 GGGAATCAGCAAAATGATTCTGG + Intergenic
1100535307 12:95503396-95503418 GAGAACAAGAAAAATGAGTATGG + Intronic
1101700467 12:107169148-107169170 TAGAAAGAACAAAATGATTATGG - Intergenic
1104188866 12:126458648-126458670 TGGAATGAGCAAAAAGATTAAGG - Intergenic
1104799551 12:131544376-131544398 AAGAAACAGCAAAATGATGTAGG + Intergenic
1107818239 13:44263449-44263471 TAGCACCCCCAAAATGATTCTGG - Intergenic
1108805784 13:54154544-54154566 TTGAACCAGATAAATGATGAGGG - Intergenic
1109860575 13:68192693-68192715 TATATCCAGGAAAATGATTGAGG - Intergenic
1110934590 13:81271525-81271547 AAGAACCAGCAAATTGGTCACGG + Intergenic
1111886326 13:94026534-94026556 TGGAACCAACCAAATGAATATGG + Intronic
1112198641 13:97252366-97252388 AAGAACCTGAAAAATGATTGTGG - Intronic
1112743211 13:102497796-102497818 GAGAAAGAGCAAAGTGATTATGG + Intergenic
1114684376 14:24514168-24514190 GAAGACCAGCAAAATGATCAGGG + Intergenic
1114865456 14:26588399-26588421 TTTTAACAGCAAAATGATTAAGG - Intronic
1114942947 14:27638775-27638797 TAAAAACAGGAAAATGGTTAAGG - Intergenic
1115930084 14:38481841-38481863 GAGGCACAGCAAAATGATTATGG + Intergenic
1116063991 14:39959005-39959027 AGGAACCAGAAAAATAATTATGG + Intergenic
1117849770 14:59955493-59955515 TAGAACAATAAAAATGATAAAGG - Intronic
1120290774 14:82567820-82567842 TGGAACCAGGAAAAAGGTTAAGG - Intergenic
1120643990 14:87050227-87050249 AAGAATCAGCAAAGTGATTAGGG - Intergenic
1125993656 15:44134908-44134930 GAGAAACAGCAAGAAGATTAGGG + Intronic
1127652905 15:61026381-61026403 TAGAAGCAGCAAAATTACAACGG + Intronic
1127845946 15:62871069-62871091 TAGACCCAGCAATCCGATTACGG - Intergenic
1131104472 15:89722857-89722879 AAAAACCAGAAAAATGTTTACGG + Intronic
1131189569 15:90303126-90303148 TAGAACCTGAAAAATATTTAAGG - Intronic
1131659691 15:94500304-94500326 TAAAATCAGCAAAATGAAGATGG - Intergenic
1132424553 15:101703858-101703880 TAAAACCATCAAAATTTTTAAGG - Exonic
1133382133 16:5340026-5340048 CAGCACCAGCAAAATCAGTATGG + Intergenic
1133437413 16:5791900-5791922 AAGAACCAGCAAGATGACTGAGG + Intergenic
1133532365 16:6666894-6666916 CAGAACCATCAAAATGCTCACGG + Intronic
1135102128 16:19615113-19615135 TAGACCAAGCACAAAGATTACGG - Intronic
1138888670 16:61113995-61114017 TAGAACCTGCAACATGTTCATGG - Intergenic
1146544935 17:33729869-33729891 AAGAACCAGCTGAATAATTAGGG - Intronic
1149144874 17:53478371-53478393 TAGAAACAGAAAATAGATTATGG + Intergenic
1150378678 17:64703553-64703575 TTCAACCAGAAATATGATTAGGG + Intergenic
1153113222 18:1619553-1619575 AAGACCCACCAAAATGAATATGG - Intergenic
1153179913 18:2421298-2421320 GAAAAGCAGCAAAATAATTATGG + Intergenic
1155491579 18:26406126-26406148 TAGTTCTAGCAAAATGACTAGGG - Intergenic
1157542257 18:48519570-48519592 AAGAACCAGCAAAGGTATTATGG + Intergenic
1157640671 18:49210507-49210529 TGGAGACAGCAAAAAGATTAGGG + Intronic
1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG + Intronic
1164629161 19:29750299-29750321 TAGAAACAGAAAAATGGTAATGG + Intergenic
925242780 2:2347169-2347191 TACCACCATCAATATGATTACGG + Intergenic
925851794 2:8088900-8088922 CTAAACCAGCAAAATGATTTGGG + Intergenic
927829332 2:26335214-26335236 TAGAAACAGAAAGCTGATTAGGG - Intronic
929223219 2:39486576-39486598 GAGAAGCAGCAAAATGCTTGGGG - Intergenic
929488801 2:42378467-42378489 TGGAATCACTAAAATGATTATGG + Intronic
932250098 2:70236081-70236103 TAAAAACTGCAAAATGATTATGG - Exonic
932723089 2:74153193-74153215 TAGCACCAGCACCATGACTAGGG + Exonic
932895951 2:75639948-75639970 TACACCCAGCAGAAGGATTATGG - Intergenic
933221621 2:79696462-79696484 GAGAAGCAGGAAAATGTTTACGG + Intronic
933399424 2:81774707-81774729 CAGAGCAAGTAAAATGATTAGGG - Intergenic
933615402 2:84478104-84478126 TAAAACCAGCAGAGGGATTAGGG + Intergenic
935046374 2:99487156-99487178 AAGAACCGGCAAAATGACTATGG + Intronic
935829405 2:106985007-106985029 TAGAACAAGCAAAATGACATGGG + Intergenic
936980338 2:118258243-118258265 TAGAACCGGCCAAATATTTATGG - Intergenic
937029508 2:118726472-118726494 TAGTACCAGCAAAATCTTCAGGG - Intergenic
937511794 2:122603619-122603641 TACAACCAGCAAAAAAATTAAGG + Intergenic
938968242 2:136407415-136407437 TTGAGCTAGCAAAATGATTGTGG + Intergenic
939186491 2:138867114-138867136 TAGAACCAGCACAGTTATTATGG + Intergenic
939432292 2:142126689-142126711 TATAACCAGGAAAATGCTGAAGG + Intronic
940263585 2:151812165-151812187 CAGAAGCAGCAGAAAGATTATGG - Intronic
941850058 2:170171386-170171408 TGGAAACAACAAAATGCTTATGG + Intergenic
943037237 2:182762374-182762396 TAGAAACAGAAACATGTTTATGG + Intronic
944103215 2:196051917-196051939 GAGAACAAGTTAAATGATTAGGG - Intronic
945387125 2:209215504-209215526 AAGAACCAGAAAAATGATTGTGG + Intergenic
947322504 2:228937772-228937794 TAGAATCATAAAAATGATGAAGG + Intronic
1170142292 20:13137076-13137098 TTGTACCAGCACAATGATTGGGG - Intronic
1170173680 20:13443102-13443124 GAAAACCAGCAAAATGCTGAAGG - Intronic
1170203256 20:13768046-13768068 CAGAACCAACATAATGATCAGGG - Intronic
1172833142 20:37853761-37853783 TAAAATAAGCAGAATGATTATGG - Intronic
1173708907 20:45137386-45137408 TAGAAACATTAAAAAGATTAAGG + Intergenic
1174756213 20:53161014-53161036 AAGAAACAGCAAAATGTTTGGGG + Intronic
1176761683 21:10803167-10803189 TAGAACCTGCAAAGTGATATTGG - Intergenic
1178299593 21:31441131-31441153 TTGAACCAGCAAAATCACAAAGG - Intronic
1179587197 21:42380977-42380999 GAGAAGCAGGAAAATGATTATGG - Intronic
950243306 3:11391621-11391643 TAGAAAAAGCAAGATGATTGAGG - Intronic
951173043 3:19565127-19565149 AGGAACCAGCATAATGATCAGGG - Intergenic
952134726 3:30404591-30404613 TAGCACAAGAAAAATGAGTAAGG + Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955280703 3:57591869-57591891 TAGAAACAGAAAACAGATTACGG + Intronic
957371225 3:79296817-79296839 AATAACAAGCAAAAAGATTATGG - Intronic
958132357 3:89444339-89444361 TCAAACGAGCAAAATTATTATGG - Intronic
959066694 3:101664130-101664152 TAGAACCACCAAAATGTCTCAGG - Intronic
959871397 3:111332633-111332655 TATATCCATCAAAATGATTGAGG + Intronic
960264942 3:115610443-115610465 GAAAACCAGCAAAATAATTTTGG + Intergenic
963127162 3:141826960-141826982 TAGAATCAGCAAACTGCTTGTGG - Intergenic
964823404 3:160798471-160798493 TAGATCTAGCAAAATTTTTAAGG - Intronic
965459944 3:168950077-168950099 TAGACCAAGGAAAAGGATTAGGG + Intergenic
965949875 3:174296021-174296043 TAAAACCATGAAAAAGATTAAGG + Intergenic
967613791 3:191540329-191540351 TAGAAAAAGCCAAATGAGTAAGG - Intergenic
967710049 3:192696407-192696429 TAGAATCAGCAAACAGATGAGGG + Intronic
968586957 4:1423099-1423121 CAGAACGAGAAAAATTATTAGGG - Intergenic
971050308 4:22854897-22854919 AGGAACCAGAAAAATAATTATGG - Intergenic
971168732 4:24211448-24211470 CAGAACCAGCAAATTTACTAAGG + Intergenic
971721772 4:30254744-30254766 AAGAACCAGAAAAATAATTCTGG - Intergenic
972936793 4:44146308-44146330 TAAGACCAACAAAATAATTAAGG - Intergenic
973065414 4:45783819-45783841 TTGCACCAGCAAACTGAATAAGG + Intergenic
973238102 4:47927921-47927943 GAGAACTAAGAAAATGATTAAGG + Intronic
974290147 4:59919205-59919227 TAGAACCAGAAAACTGATGTTGG + Intergenic
976934861 4:90617609-90617631 TAGAAGCTGCAAAATGTTTTAGG - Intronic
977171453 4:93767705-93767727 AAGAACAAGCAACATGATAAAGG - Intronic
977259130 4:94777465-94777487 TAATAACAGAAAAATGATTAGGG - Intronic
978083007 4:104617402-104617424 TAGAATTAGCATAATGTTTAAGG + Intergenic
979688123 4:123533528-123533550 TAGAACCAAAAAAATGAATTTGG + Intergenic
980286790 4:130789785-130789807 AATAACAAGTAAAATGATTATGG - Intergenic
980421015 4:132561210-132561232 TATAACCTGCAAAATGATTCCGG + Intergenic
980536310 4:134127701-134127723 AAGAACCAGAAAAACGATTCTGG + Intergenic
980756925 4:137177057-137177079 TAGCACCAGCAAACTAATAAAGG - Intergenic
980858763 4:138473322-138473344 TTCCACCAGCAAAATTATTATGG + Intergenic
981139570 4:141253055-141253077 AAGAACCAGAAAAATAATTCTGG - Intergenic
981165091 4:141548367-141548389 TAGAACAAGGAAAAAGATGAAGG + Intergenic
982447695 4:155512889-155512911 TAAAACCTGCAAGATGATAAGGG - Intergenic
983042174 4:162942731-162942753 TATAACCAAAAAAATGATTTTGG - Intergenic
983086450 4:163450809-163450831 TAGATTCAGCATAATTATTAAGG + Intergenic
983578538 4:169284829-169284851 TACTAACAGCAAAATGATTGCGG - Intergenic
983651263 4:170039200-170039222 TAGAAAGAGCAAAATGATCATGG - Intergenic
988210880 5:28201786-28201808 TAGAAATTGCAAAATGATAACGG - Intergenic
988306804 5:29503362-29503384 TAGAACCAGAAAAATCTATAAGG + Intergenic
988889602 5:35600139-35600161 AAGAACCAGAAAAATAATTCTGG + Intergenic
989000307 5:36752909-36752931 TGGAAACTGCAAAATGATTTGGG + Intergenic
990901273 5:60752216-60752238 TAGAAACATCAACATGATTGTGG - Exonic
991052326 5:62286594-62286616 TAGAAATAGCAAGAAGATTATGG + Intergenic
991069440 5:62460230-62460252 TTGAGCCAGAAAAATGAATAAGG + Intronic
991187204 5:63823702-63823724 TGGAACCAACAAGATGAATAAGG + Intergenic
991448151 5:66722429-66722451 CAGAACCAGGTAAATGAGTAAGG - Intronic
992423514 5:76631105-76631127 TAGAACCAGAAAAATGAAAGAGG - Intronic
992600368 5:78392383-78392405 TAGCACTAGCAAAATGAAAAAGG - Intronic
993368652 5:87064307-87064329 TAGAAACAGCATAATTCTTAAGG + Intergenic
993583711 5:89696819-89696841 TAGAGTCTGCAAAATGATTGGGG - Intergenic
995047284 5:107666832-107666854 TAGAAGCACCAAACTGCTTATGG + Intronic
995376747 5:111482460-111482482 CAGAACCAGCAAAATAATTCTGG - Intronic
995573485 5:113505780-113505802 TAGAAAAAGCAAAATGTATATGG + Intergenic
996197907 5:120632277-120632299 AAGAACCAGAAAAATAATTCTGG + Intronic
999943507 5:156570086-156570108 TAGAAGCAGGAAAATCAATATGG + Intronic
1000197548 5:158973990-158974012 AAACACCAGCAAAATGATTTAGG - Intronic
1000562730 5:162810759-162810781 TAGAAAAAGCAAAAAGAATAGGG - Intergenic
1001847133 5:174932286-174932308 CAGAACCACAAAAATGACTAGGG - Intergenic
1001890353 5:175333233-175333255 AAGAACCAGGAAAGTGTTTAAGG - Intergenic
1003569803 6:7248348-7248370 TTGAACCAGCAAACTGAGGACGG - Intronic
1004151579 6:13125020-13125042 AAGCACCAGTAAAATGATAAAGG + Intronic
1004550397 6:16641439-16641461 TAGATTCAGCATAATTATTAGGG - Intronic
1007597603 6:43061039-43061061 TAGAACTAGCAGAAGGATTTAGG - Intronic
1007908708 6:45490777-45490799 AAGAACCACCAAGATGATGATGG - Intronic
1008107758 6:47458377-47458399 TAGAACTATCATAAGGATTATGG + Intergenic
1008213308 6:48752843-48752865 TTAAAACAGCAAAATGATTCTGG - Intergenic
1008412649 6:51198594-51198616 AAGAACCAACAAAAATATTAGGG + Intergenic
1009972108 6:70635545-70635567 TAGAACTAGCAGGAAGATTAGGG + Intergenic
1012016249 6:93856095-93856117 AAGAACCAGAAAAATAATTCTGG - Intergenic
1012575528 6:100792533-100792555 TAGAACTAGTAAAATCATCATGG + Intronic
1013698961 6:112739449-112739471 TAGATTCAGCATAATTATTAAGG + Intergenic
1014505894 6:122255328-122255350 CAGAACCAGCAAAATAAATTTGG - Intergenic
1015210739 6:130695554-130695576 TACACCCAGGAAAATGATTAGGG + Intergenic
1016077705 6:139817009-139817031 CAGAACTAGCAAAATGCTGATGG - Intergenic
1016090962 6:139978442-139978464 TCTAACCAGAAAAATGAATAAGG - Intergenic
1016454809 6:144219715-144219737 AAAAACAAGCAAAATAATTAAGG - Intergenic
1016507737 6:144802360-144802382 TAGAACCAACAGAATGAAAATGG - Intronic
1017181865 6:151562115-151562137 AAAAACCAGAAAAATGATTCAGG - Intronic
1020018656 7:4847817-4847839 TAGAGCCAGAAAACTGATCAGGG + Intronic
1020920693 7:14260307-14260329 TATAAGCAGCATTATGATTATGG + Intronic
1021047002 7:15935575-15935597 TAGACCCAGAAAAATGTTCAAGG - Intergenic
1021570659 7:22061788-22061810 AAGAACCAGCCACATAATTAAGG + Intergenic
1024384591 7:48737431-48737453 CAGAACCAATAAAATGATTATGG + Intergenic
1027562853 7:79753887-79753909 TAGAACCTGTAAAATAATTCAGG - Intergenic
1027571791 7:79877508-79877530 TAGAAACATCAAAAATATTAAGG - Intergenic
1027798873 7:82726747-82726769 TAGAAATAGCCAAATGAATATGG + Intergenic
1028444708 7:90908347-90908369 TGGATCCAGCAAAAGAATTAAGG + Intronic
1028764874 7:94543047-94543069 TTGAATAAGCAAAATGCTTAGGG + Intronic
1029901701 7:104047876-104047898 TACATCCATCAACATGATTAAGG - Intergenic
1030472516 7:109983424-109983446 TAGAAACAGCAAAACCAATAGGG + Intergenic
1033838532 7:145345343-145345365 TAGATCCATCAAAATTATAATGG - Intergenic
1033904727 7:146188431-146188453 TCGAACTAGCTAAATGCTTAGGG - Intronic
1033954391 7:146826988-146827010 GAGAACCACTAACATGATTAAGG + Intronic
1037190975 8:16124974-16124996 TAGAAACAGAAAAATCATGAAGG + Intronic
1039524675 8:38203621-38203643 TAGGACAAGCAAGATGAGTAGGG + Intronic
1039702487 8:39976622-39976644 TAGAATCTGCAACATGATTCAGG - Intronic
1041443475 8:57924676-57924698 TAGATACAGTAAAATTATTATGG - Intergenic
1042302099 8:67295164-67295186 GAGAAACAGGAAAATCATTAGGG + Intronic
1042692510 8:71517067-71517089 TAGAACCAGCAAGAGGAGAAGGG - Intronic
1043654448 8:82644683-82644705 ACAAACCAGCAAAATCATTAGGG - Intergenic
1044950683 8:97432895-97432917 TAGAAGCAGGAAAATGAGTTAGG + Intergenic
1045752881 8:105507436-105507458 TGTAACCACCATAATGATTATGG + Intronic
1046297936 8:112246221-112246243 CAGAACCATCCAAATGATTGTGG - Intronic
1046744137 8:117858982-117859004 CTTCACCAGCAAAATGATTATGG + Intronic
1046789156 8:118302529-118302551 TAGAACCAGGACATGGATTATGG - Intronic
1047633505 8:126733866-126733888 TAAAACCAGAAAAATGAAAAAGG - Intergenic
1051723941 9:20068851-20068873 TGAAACCAGAAAAATGAGTAGGG - Intergenic
1053587364 9:39473582-39473604 TAGAAGCAGCAAAATGGTGCTGG - Intergenic
1054578937 9:66891654-66891676 TAGAAGCAGCAAAATGGTGCTGG + Intronic
1056025897 9:82495401-82495423 AGGAACCAGAAAAATGATTCTGG - Intergenic
1057431059 9:94994550-94994572 TAAAACCAGTATAATAATTAAGG - Intronic
1059711966 9:116876684-116876706 CTGCACCAGCAAAATGATTATGG + Intronic
1059833722 9:118127497-118127519 TAGATCTAGCATAATTATTAAGG - Intergenic
1059933239 9:119282368-119282390 AAGATCCAGCAAAATGGGTAAGG + Intronic
1060328425 9:122641943-122641965 TAGAATAAAGAAAATGATTAGGG + Intergenic
1060534208 9:124370286-124370308 TAAAAATAGCCAAATGATTATGG - Intronic
1186322374 X:8443021-8443043 TTGAAGAAGAAAAATGATTATGG - Intergenic
1186615332 X:11180156-11180178 TAGACCTAGTATAATGATTAAGG - Intronic
1186750546 X:12617304-12617326 TATACCCAGCAAAATATTTATGG - Intronic
1186946653 X:14575915-14575937 TAGACCCAGCCAATTGATTTAGG - Intronic
1187541072 X:20195958-20195980 TAGCACCATGAATATGATTAAGG + Intronic
1187658093 X:21503958-21503980 TAGAGCCAACAAATTGATTTTGG + Intronic
1190038091 X:47044756-47044778 TAGAAACAGCAAAAAGTTAAGGG + Intronic
1191008419 X:55736563-55736585 AGGAACCAGAAAAATGATTCTGG - Intronic
1192310583 X:70010368-70010390 CAGAGCAAGGAAAATGATTAGGG - Intronic
1192537578 X:71941422-71941444 TAAAACAAGCAGAATGGTTAAGG + Intergenic
1193308168 X:79974194-79974216 TAGAAACAGAAAAATAATTTTGG - Intergenic
1195179976 X:102348771-102348793 TTGAACCTGCAAATTGCTTAGGG + Intergenic
1196107962 X:111916432-111916454 TAAAAACAGCAAGATGATGAAGG - Intronic
1197173200 X:123457068-123457090 TAGAGACAGCAAAATGAGTGAGG + Intronic
1197474737 X:126907313-126907335 TAGAACAAGAAAAATTATTAGGG + Intergenic
1197604088 X:128564063-128564085 TAGAAGCAGCACAATAATAATGG + Intergenic
1200807281 Y:7445784-7445806 TAGAACCTTCAACATGATGATGG - Intergenic
1200872231 Y:8114236-8114258 TTGAAGCAGTAAAAAGATTAGGG - Intergenic