ID: 1088961364

View in Genome Browser
Species Human (GRCh38)
Location 11:114669121-114669143
Sequence AGAGCTTCTCACATTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088961364_1088961366 -3 Left 1088961364 11:114669121-114669143 CCAGCAAAAATGTGAGAAGCTCT No data
Right 1088961366 11:114669141-114669163 TCTGTGGACCCTCTCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088961364 Original CRISPR AGAGCTTCTCACATTTTTGC TGG (reversed) Intergenic
No off target data available for this crispr