ID: 1088963204

View in Genome Browser
Species Human (GRCh38)
Location 11:114691752-114691774
Sequence AGCTCACCAAAGCCCCCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 2, 1: 2, 2: 5, 3: 33, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088963204_1088963216 15 Left 1088963204 11:114691752-114691774 CCCAAGGGGGGCTTTGGTGAGCT 0: 2
1: 2
2: 5
3: 33
4: 171
Right 1088963216 11:114691790-114691812 TTAGGGGCAGATAGTGCTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 171
1088963204_1088963208 -1 Left 1088963204 11:114691752-114691774 CCCAAGGGGGGCTTTGGTGAGCT 0: 2
1: 2
2: 5
3: 33
4: 171
Right 1088963208 11:114691774-114691796 TGTGCTCCCCCTTCCCTTAGGGG 0: 2
1: 2
2: 17
3: 57
4: 274
1088963204_1088963207 -2 Left 1088963204 11:114691752-114691774 CCCAAGGGGGGCTTTGGTGAGCT 0: 2
1: 2
2: 5
3: 33
4: 171
Right 1088963207 11:114691773-114691795 CTGTGCTCCCCCTTCCCTTAGGG 0: 2
1: 3
2: 9
3: 67
4: 373
1088963204_1088963206 -3 Left 1088963204 11:114691752-114691774 CCCAAGGGGGGCTTTGGTGAGCT 0: 2
1: 2
2: 5
3: 33
4: 171
Right 1088963206 11:114691772-114691794 GCTGTGCTCCCCCTTCCCTTAGG 0: 2
1: 3
2: 11
3: 100
4: 389
1088963204_1088963217 29 Left 1088963204 11:114691752-114691774 CCCAAGGGGGGCTTTGGTGAGCT 0: 2
1: 2
2: 5
3: 33
4: 171
Right 1088963217 11:114691804-114691826 TGCTGAGGGTTAGATCTCCAAGG 0: 2
1: 4
2: 10
3: 26
4: 144
1088963204_1088963215 14 Left 1088963204 11:114691752-114691774 CCCAAGGGGGGCTTTGGTGAGCT 0: 2
1: 2
2: 5
3: 33
4: 171
Right 1088963215 11:114691789-114691811 CTTAGGGGCAGATAGTGCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088963204 Original CRISPR AGCTCACCAAAGCCCCCCTT GGG (reversed) Intronic
902628052 1:17688334-17688356 AGCTCACCAAATGCCCCCCAAGG + Intronic
906228802 1:44142822-44142844 AGCTCCCCAAAGCCACCATCTGG + Intergenic
906245786 1:44273060-44273082 AGCTCTCCAAAACCACACTTAGG + Intronic
907656142 1:56343309-56343331 AGTCTACCAAAGCCCTCCTTAGG + Intergenic
908247962 1:62242946-62242968 TGCTCCCCAAAGTCACCCTTGGG + Intronic
912624335 1:111195078-111195100 AGGTCACAGAGGCCCCCCTTTGG + Intronic
917276375 1:173336097-173336119 AGCTCACCAAATCCCCACATTGG + Intergenic
917688692 1:177445115-177445137 AGGTCACCAAAGCCACCTTCTGG - Intergenic
919283239 1:195518816-195518838 AGCCCATCAAAGCCCCCCTTGGG + Intergenic
1063204134 10:3814445-3814467 AGGTGACCAAGGCTCCCCTTCGG - Intergenic
1065887891 10:30094901-30094923 AGCACACCAAGTCCCCCATTTGG + Intronic
1066054316 10:31666278-31666300 AGCTAACCAAAGCTCCCTTAAGG - Intergenic
1066357629 10:34700398-34700420 AACTCACAAAAGCTCGCCTTAGG - Intronic
1067535483 10:47106684-47106706 AGCTCAGCATAGCCCCCTCTGGG + Intergenic
1067580159 10:47439678-47439700 AGCCTGCCAAAGCCCCTCTTAGG - Intergenic
1067732270 10:48820761-48820783 AGCACCCCAGAACCCCCCTTGGG - Intronic
1069044206 10:63724812-63724834 GCCTCCCCAAAGCCCCCCTTGGG + Intergenic
1069063300 10:63916368-63916390 AGATCCCCAAATCCCCCCATGGG - Intergenic
1069336602 10:67358792-67358814 AGCCCACCAGGGACCCCCTTGGG + Intronic
1071737527 10:88318301-88318323 AGCCCACTAAAGTCTCCCTTGGG + Intronic
1072877608 10:99189916-99189938 AGCTGGCCAAAGCAGCCCTTGGG - Intronic
1074550520 10:114438155-114438177 CACTCAACAAAGCCCCCCTAAGG - Intronic
1075886069 10:125900429-125900451 AGATCCCCAAAGCCACCCCTTGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077252779 11:1567904-1567926 AGCTCATCAAGGACCCCCTGTGG - Intronic
1077395328 11:2317655-2317677 AGCTCACCAAATCCCTCCATGGG + Intronic
1078102706 11:8339169-8339191 CGCTCCCCAAACCCCTCCTTTGG - Intergenic
1085219970 11:74865417-74865439 AACTGACCATAGGCCCCCTTGGG - Intronic
1085338800 11:75718082-75718104 AGCGCAACAAAGCCCCCTTTAGG - Intronic
1085876028 11:80406604-80406626 AGCCCACAAAAGCCTCCCTTAGG + Intergenic
1087625196 11:100587789-100587811 ATCTCACGAAAGCCCCCATCAGG - Intergenic
1088963204 11:114691752-114691774 AGCTCACCAAAGCCCCCCTTGGG - Intronic
1088986622 11:114914763-114914785 AGCCCCCCAGAGCCTCCCTTGGG - Intergenic
1097711114 12:62918465-62918487 AGCTCACCAAAACACTACTTTGG + Intronic
1098202206 12:68068274-68068296 AGCCTGCCAAAGCCCCCCTAGGG - Intergenic
1101541776 12:105672012-105672034 CCCTCACCAAAGCCATCCTTGGG - Intergenic
1104084605 12:125462612-125462634 AGCTCACCCATGCCTCACTTCGG - Intronic
1104769396 12:131351500-131351522 GGCTCACCAAGGCCCACCTGGGG + Intergenic
1105434307 13:20363541-20363563 AGGACTCCAGAGCCCCCCTTGGG + Intergenic
1107310680 13:39073921-39073943 AGCCCACCAAAGTCCCCCATGGG + Intergenic
1108887116 13:55200078-55200100 AGCCCACCAAAGCACCTCTTGGG - Intergenic
1110826126 13:79974278-79974300 AGCTCACCAAAGCTCCCCTTGGG - Intergenic
1110985057 13:81956667-81956689 AGTCCACCAAAGCTCCCCTCAGG + Intergenic
1111116093 13:83779749-83779771 AGCCCATCAAAGCCTCCTTTGGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1120400328 14:84022973-84022995 AGCTCAGCAAACCCCACCTAAGG - Intergenic
1120977684 14:90263929-90263951 AGATCACCAAAGCACTCCTCAGG + Intronic
1122784344 14:104156944-104156966 AGCTCTCCAAGGACCCCCTTGGG - Intronic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202872007 14_GL000225v1_random:173535-173557 AGATCCCCAAAGCCACCCCTTGG + Intergenic
1124158256 15:27247339-27247361 AGCTCTGCAAAGCCCCTCTCAGG + Intronic
1124523138 15:30423099-30423121 AGCTAACCAAAGGCATCCTTGGG + Intergenic
1124535528 15:30543117-30543139 AGCTAACCAAAGGCATCCTTGGG - Intergenic
1124763126 15:32464479-32464501 AGCTAACCAAAGGCATCCTTGGG + Intergenic
1124775501 15:32584580-32584602 AGCTAACCAAAGGCATCCTTGGG - Intergenic
1130210137 15:81914905-81914927 AGCTAACCAGAGCCTCCCTTGGG - Intergenic
1131330083 15:91489694-91489716 AACCCAGCAATGCCCCCCTTAGG - Intergenic
1136703022 16:32160473-32160495 GGCTCACCCAAGCCCACCTTTGG - Intergenic
1136764678 16:32767123-32767145 GGCTCACCCAAGCCCACCTTTGG + Intergenic
1136803421 16:33103261-33103283 GGCTCACCCAAGCCCACCTTTGG - Intergenic
1137822357 16:51458257-51458279 AGCAAACCCAAGCCCCACTTTGG + Intergenic
1138810052 16:60139230-60139252 AGGTCACCAAAGACCCCCTTGGG - Intergenic
1203067034 16_KI270728v1_random:1029248-1029270 GGCTCACCCAAGCCCACCTTTGG + Intergenic
1145755140 17:27384803-27384825 AGCTCACCCAATCCCCCATTTGG - Intergenic
1145793791 17:27644120-27644142 AGCTCACTCAAGGCCCTCTTGGG + Intronic
1145999783 17:29124349-29124371 AACTCAACCAGGCCCCCCTTGGG + Intronic
1147262021 17:39214310-39214332 AGCTCCCCAAAGCCACCCTGCGG - Exonic
1152410133 17:80118917-80118939 TCCTCCCCAAAGACCCCCTTGGG - Intergenic
1155324978 18:24656191-24656213 AGCTCCACAAAGCCTCCCTGTGG + Intergenic
1157743475 18:50114417-50114439 AGCTAACCAAGGCTCCTCTTGGG + Intronic
1161761064 19:6173110-6173132 AGCCCACCAAAGCCCCCCTTGGG - Intronic
1166717856 19:44980206-44980228 AGTTCAGAAAAGCCCCCTTTTGG + Intronic
1168130033 19:54312123-54312145 ACCTCTCCAAAGCCACCCTCTGG - Exonic
1202647900 1_KI270706v1_random:158154-158176 GTGTCCCCAAAGCCCCCCTTGGG - Intergenic
926219472 2:10925377-10925399 AGCTCCCCAAATCCCACCCTGGG - Intergenic
926219481 2:10925400-10925422 AGCTCCCCAAATCCCTCCCTGGG - Intergenic
926219504 2:10925467-10925489 AGCTCCCCAAATCCCTCCCTGGG - Intergenic
926219529 2:10925534-10925556 AGCTCCCCAAATCCCTCCCTGGG - Intergenic
926219546 2:10925579-10925601 AGCTCCCCAAATCCCTCCCTGGG - Intergenic
927349681 2:22094476-22094498 AGCCCACCAGAGCTCCCCTTGGG - Intergenic
930993367 2:57686164-57686186 AACCCACCAAAGCTCCTCTTGGG + Intergenic
933644553 2:84799731-84799753 ACTCCACCAAAGCCCCACTTGGG + Intronic
939275359 2:139991608-139991630 AGCACACCAAAGCTGCCCTAAGG - Intergenic
943374250 2:187055323-187055345 AGCTCACCAAATCCCCTCTGGGG - Intergenic
944017117 2:195054629-195054651 AGCTCCTCAAAGCCACCCTTAGG + Intergenic
944826130 2:203484921-203484943 AGCTCACCACAGGCCCTTTTTGG + Intronic
945038703 2:205726440-205726462 ACCTCAACAAACCTCCCCTTAGG - Intronic
946505267 2:220293627-220293649 GGCACACAAAAGCCTCCCTTTGG + Intergenic
947640799 2:231706877-231706899 AGCTCAGCAAAGCCCCGCTGTGG + Intronic
947751853 2:232536866-232536888 AGGTCACCAATTCCCCCCTGAGG - Intergenic
948197450 2:236106351-236106373 AGCTCACCAGAGCCGGCCTAAGG + Intronic
948410292 2:237754781-237754803 AGCACAGCCCAGCCCCCCTTCGG + Intronic
1170070249 20:12358486-12358508 AGCTGACCAAAGGCCACCTTGGG + Intergenic
1171436890 20:25130964-25130986 AGCTGACCACAGCCCAGCTTTGG - Intergenic
1171770389 20:29318928-29318950 CGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172339232 20:34143236-34143258 GGCCTGCCAAAGCCCCCCTTGGG - Intergenic
1175339359 20:58218414-58218436 TGCTCACCAAGGGCCCCCATGGG + Intergenic
1175716821 20:61260572-61260594 AGCTCACCCAAGCCACCAGTGGG - Intronic
1175743220 20:61435414-61435436 AGCCCAGCAGAGCCCCCCTAGGG - Intronic
1176603949 21:8814575-8814597 GTGTCCCCAAAGCCCCCCTTGGG + Intergenic
1176711300 21:10152148-10152170 AGCTTGCCAAAGCCACCCCTTGG - Intergenic
1177015977 21:15787802-15787824 AGCTCACCTAAGCCCCTTTTTGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180346233 22:11706152-11706174 GTGTCCCCAAAGCCCCCCTTGGG + Intergenic
1180354002 22:11824309-11824331 GTGTCCCCAAAGCCCCCCTTGGG + Intergenic
1180384243 22:12168016-12168038 GTGTCCCCAAAGCCCCCCTTGGG - Intergenic
1181641043 22:24198781-24198803 AGCTCACCAAAACCTCCAGTGGG - Intergenic
1183313085 22:37122066-37122088 AGCTGATCACAGCCCTCCTTCGG - Intergenic
1185143840 22:49118734-49118756 AGCTCAGCAAAGCCTCCAGTTGG - Intergenic
951686154 3:25346870-25346892 TGCTCACCAGAGCCTCCTTTTGG - Intronic
952285147 3:31961161-31961183 AGCTCTCCAAACCCACTCTTTGG + Intronic
952652405 3:35741908-35741930 AGCTAACCAAAGCGCCACCTTGG + Intronic
954502254 3:51029617-51029639 AGCACACCAAAGCCCCGCCTTGG - Intronic
956560021 3:70565111-70565133 AGCTCACCAAAGCACTCCTTGGG - Intergenic
956907942 3:73786368-73786390 ACCTCATCAAAACCCCCCTCAGG + Intergenic
959373537 3:105559521-105559543 AGCTCTCCAAAGTCCCTTTTAGG + Intronic
959494233 3:107030696-107030718 AGCCCACCAAAGTCCCCTTTGGG + Intergenic
959883680 3:111474690-111474712 AGTTCACCAAAGCTGCCCCTTGG + Intronic
963227021 3:142872668-142872690 AGCTCACCAAATAACCCCTAAGG + Intronic
963334924 3:143963631-143963653 AGTTCCCCAAAACCCCCCTCAGG - Intergenic
965261317 3:166489522-166489544 AGCTGCCCTAAGCCCCCCATAGG - Intergenic
970184072 4:13430856-13430878 AGCCCACCAAAACCCACCTTGGG + Intronic
974180546 4:58379378-58379400 AGTCTACCAAAGACCCCCTTGGG - Intergenic
975745870 4:77473418-77473440 AGCCCACCAAAGCACCCCTCGGG + Intergenic
976080087 4:81345948-81345970 AGCCCACCAGGGCCTCCCTTGGG - Intergenic
978926522 4:114252124-114252146 AGCTCACCAAAGCCCCCCTTGGG + Intergenic
980088353 4:128415926-128415948 AGCCCACCCAAGACCCCCTTGGG - Intergenic
980688565 4:136261301-136261323 AGCCCACCAAAGACCCCTTGGGG + Intergenic
981573541 4:146178459-146178481 AGCTCTCTAAATCCTCCCTTCGG - Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
986134316 5:4959935-4959957 AGCTTAGCCAAGACCCCCTTAGG - Intergenic
989323757 5:40165995-40166017 AGCCTACCACAGCACCCCTTGGG + Intergenic
990608034 5:57429727-57429749 AGCTACCCAAAGCCCCTCTTTGG - Intergenic
993364520 5:87019749-87019771 AGCACAACAAAGCACCCCTTGGG - Intergenic
994591877 5:101783871-101783893 AGCTCTCCAAAGCATTCCTTGGG - Intergenic
995780779 5:115773180-115773202 AGCTGAGCAAAGCCCCCACTGGG + Intergenic
996273855 5:121640634-121640656 AGCCCACCAAAGCCCCTTTTGGG + Intergenic
1006770155 6:36546760-36546782 AGATGTCGAAAGCCCCCCTTGGG - Intronic
1006795923 6:36732270-36732292 CACTCAGCAAAGCCCTCCTTTGG - Exonic
1007095287 6:39209187-39209209 TGGTCACCAAGGCCCCCATTTGG + Intronic
1009706060 6:67253391-67253413 AGCTAACAAGAGCCCCCCTGGGG + Intergenic
1012523208 6:100145412-100145434 ACCTCACCAAGGCCCTTCTTAGG + Intergenic
1013470641 6:110460878-110460900 AGCCCACCAAAGTGCTCCTTGGG + Intronic
1014022427 6:116606295-116606317 AGCTTGCCAAAGCCCCCTTTAGG + Intergenic
1017781925 6:157721988-157722010 AGCTCTCCTAAGTCCTCCTTTGG + Intronic
1018824504 6:167398949-167398971 AGCTCCCCACAGCCCCTCTGAGG - Intergenic
1018904462 6:168067085-168067107 GGCTCACCACAGTCCCCCTGCGG + Intronic
1020715854 7:11674145-11674167 GGCCCACTAAATCCCCCCTTGGG + Intronic
1021215719 7:17913161-17913183 ACCCCACCAAAACCCACCTTGGG + Intronic
1028185853 7:87784858-87784880 AGCCAACCAGAGTCCCCCTTAGG - Intronic
1028532366 7:91851876-91851898 AGCCCACCAAAGCCCCACTTAGG + Intronic
1034412879 7:150950440-150950462 AGCTCAGCACACCCTCCCTTGGG + Intronic
1035048215 7:155982988-155983010 ATTTCTCCAAAGCCACCCTTAGG - Intergenic
1039573076 8:38602462-38602484 AGCTCACTCCAGCCCCTCTTGGG + Intergenic
1040087817 8:43364421-43364443 AGCATACCACAGCCCCCCTACGG + Intergenic
1040301290 8:46189298-46189320 AGCCCACCTAAGCCACCCTGTGG - Intergenic
1040482869 8:47842154-47842176 AGCCCACCAGGGCCCCCCTTGGG + Intronic
1040545175 8:48393352-48393374 AGCCCAACACAGCCCCTCTTTGG - Intergenic
1041584540 8:59500178-59500200 AGTATACCAAAGCTCCCCTTTGG - Intergenic
1049289329 8:141793311-141793333 AGCTCATCAAAGCCCCTCAAAGG - Intergenic
1049631150 8:143658364-143658386 AGCTCACCCAGGGCCACCTTAGG - Intergenic
1053648289 9:40137839-40137861 AGCTTGCCAAAGCCACCCCTTGG - Intergenic
1053757450 9:41326002-41326024 AGCTTGCCAAAGCCACCCCTTGG + Intergenic
1054329263 9:63735782-63735804 AGCTTGCCAAAGCCACCCCTTGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1054536293 9:66238331-66238353 AGCTTGCCAAAGCCACCCCTTGG + Intergenic
1056589054 9:87951149-87951171 AGCCTGCCAGAGCCCCCCTTGGG - Intergenic
1061883371 9:133578916-133578938 GGCTCAGCCAAGCCCCACTTGGG + Exonic
1062408226 9:136408183-136408205 TGCTCACTAAAGCTCCCCTGGGG + Intronic
1062546396 9:137065453-137065475 AGCTCACCCCAGGCACCCTTGGG - Intronic
1202796055 9_KI270719v1_random:121137-121159 AGCTTGCCAAAGCCACCCCTTGG - Intergenic
1203697843 Un_GL000214v1:114252-114274 GTGTCCCCAAAGCCCCCCTTGGG - Intergenic
1203732439 Un_GL000216v2:103026-103048 AGATCCCCAAAGCCACCCCTTGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1203377280 Un_KI270442v1:385682-385704 GGCTCACGAAAGCCCCCACTGGG + Intergenic
1188885796 X:35547302-35547324 AGCCCACCAAACCCTTCCTTGGG + Intergenic
1191167651 X:57407058-57407080 AGCCCTCCAAAGCACCACTTGGG - Intronic
1191588073 X:62850603-62850625 GGCTCACCAAATCCACCCTGTGG + Intergenic
1191743899 X:64465052-64465074 AGCAAACCAAACCTCCCCTTGGG + Intergenic
1194012733 X:88582831-88582853 AGCTCAACAAAGCCCACCACGGG - Intergenic
1194444017 X:93965639-93965661 AGCCCACCAATGCCTCCCTTGGG - Intergenic
1196372905 X:114998819-114998841 AGCCCACCAAAGTCCCCCTTGGG + Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic