ID: 1088965135

View in Genome Browser
Species Human (GRCh38)
Location 11:114712624-114712646
Sequence TTGTGAGGATGTGAAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088965133_1088965135 9 Left 1088965133 11:114712592-114712614 CCGCTATCAACAGAACACAAAAC No data
Right 1088965135 11:114712624-114712646 TTGTGAGGATGTGAAGAAGTTGG No data
1088965132_1088965135 21 Left 1088965132 11:114712580-114712602 CCATCAGGATGGCCGCTATCAAC No data
Right 1088965135 11:114712624-114712646 TTGTGAGGATGTGAAGAAGTTGG No data
1088965131_1088965135 29 Left 1088965131 11:114712572-114712594 CCTCACATCCATCAGGATGGCCG No data
Right 1088965135 11:114712624-114712646 TTGTGAGGATGTGAAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088965135 Original CRISPR TTGTGAGGATGTGAAGAAGT TGG Intergenic
No off target data available for this crispr