ID: 1088966525

View in Genome Browser
Species Human (GRCh38)
Location 11:114727690-114727712
Sequence CTATTTCAGAAATTATTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088966524_1088966525 27 Left 1088966524 11:114727640-114727662 CCTTACTCAAGTTTTGCTTTTAG No data
Right 1088966525 11:114727690-114727712 CTATTTCAGAAATTATTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088966525 Original CRISPR CTATTTCAGAAATTATTTAC TGG Intergenic
No off target data available for this crispr