ID: 1088969275

View in Genome Browser
Species Human (GRCh38)
Location 11:114757927-114757949
Sequence TTTATTGGGGAGGAAATATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088969262_1088969275 17 Left 1088969262 11:114757887-114757909 CCATTTTTAAGTGATTAATGTGG No data
Right 1088969275 11:114757927-114757949 TTTATTGGGGAGGAAATATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088969275 Original CRISPR TTTATTGGGGAGGAAATATA GGG Intergenic
No off target data available for this crispr