ID: 1088970084

View in Genome Browser
Species Human (GRCh38)
Location 11:114766282-114766304
Sequence TTTGATTTATAGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088970084_1088970091 18 Left 1088970084 11:114766282-114766304 CCTTCCACCTGCTATAAATCAAA No data
Right 1088970091 11:114766323-114766345 CCCTATTAGGAACCAGCTGACGG No data
1088970084_1088970087 5 Left 1088970084 11:114766282-114766304 CCTTCCACCTGCTATAAATCAAA No data
Right 1088970087 11:114766310-114766332 TTCCATGACAATCCCCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088970084 Original CRISPR TTTGATTTATAGCAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr