ID: 1088970884

View in Genome Browser
Species Human (GRCh38)
Location 11:114773757-114773779
Sequence GGCCTAAGTAGAACAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088970876_1088970884 16 Left 1088970876 11:114773718-114773740 CCTTCCCCAGTGGGGGTGAGGAT No data
Right 1088970884 11:114773757-114773779 GGCCTAAGTAGAACAAAAGGTGG No data
1088970882_1088970884 -10 Left 1088970882 11:114773744-114773766 CCTATCTGTTGAGGGCCTAAGTA No data
Right 1088970884 11:114773757-114773779 GGCCTAAGTAGAACAAAAGGTGG No data
1088970877_1088970884 12 Left 1088970877 11:114773722-114773744 CCCCAGTGGGGGTGAGGATTATC No data
Right 1088970884 11:114773757-114773779 GGCCTAAGTAGAACAAAAGGTGG No data
1088970878_1088970884 11 Left 1088970878 11:114773723-114773745 CCCAGTGGGGGTGAGGATTATCC No data
Right 1088970884 11:114773757-114773779 GGCCTAAGTAGAACAAAAGGTGG No data
1088970879_1088970884 10 Left 1088970879 11:114773724-114773746 CCAGTGGGGGTGAGGATTATCCT No data
Right 1088970884 11:114773757-114773779 GGCCTAAGTAGAACAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088970884 Original CRISPR GGCCTAAGTAGAACAAAAGG TGG Intergenic
No off target data available for this crispr