ID: 1088976255

View in Genome Browser
Species Human (GRCh38)
Location 11:114818717-114818739
Sequence CATCAGAGGCAGAGCCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088976250_1088976255 7 Left 1088976250 11:114818687-114818709 CCCTGAGCTTTCCTGAAAAACTG No data
Right 1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG No data
1088976245_1088976255 21 Left 1088976245 11:114818673-114818695 CCCAGGCCCCTTAACCCTGAGCT No data
Right 1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG No data
1088976248_1088976255 14 Left 1088976248 11:114818680-114818702 CCCTTAACCCTGAGCTTTCCTGA No data
Right 1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG No data
1088976249_1088976255 13 Left 1088976249 11:114818681-114818703 CCTTAACCCTGAGCTTTCCTGAA No data
Right 1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG No data
1088976246_1088976255 20 Left 1088976246 11:114818674-114818696 CCAGGCCCCTTAACCCTGAGCTT No data
Right 1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG No data
1088976243_1088976255 26 Left 1088976243 11:114818668-114818690 CCCTGCCCAGGCCCCTTAACCCT No data
Right 1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG No data
1088976242_1088976255 29 Left 1088976242 11:114818665-114818687 CCACCCTGCCCAGGCCCCTTAAC No data
Right 1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG No data
1088976251_1088976255 6 Left 1088976251 11:114818688-114818710 CCTGAGCTTTCCTGAAAAACTGA No data
Right 1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG No data
1088976247_1088976255 15 Left 1088976247 11:114818679-114818701 CCCCTTAACCCTGAGCTTTCCTG No data
Right 1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG No data
1088976244_1088976255 25 Left 1088976244 11:114818669-114818691 CCTGCCCAGGCCCCTTAACCCTG No data
Right 1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG No data
1088976253_1088976255 -4 Left 1088976253 11:114818698-114818720 CCTGAAAAACTGAGAGGTGCATC No data
Right 1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088976255 Original CRISPR CATCAGAGGCAGAGCCTGAA AGG Intergenic
No off target data available for this crispr