ID: 1088976446

View in Genome Browser
Species Human (GRCh38)
Location 11:114820634-114820656
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088976446_1088976449 -2 Left 1088976446 11:114820634-114820656 CCTGCACAAACAGGCCATTGGGA No data
Right 1088976449 11:114820655-114820677 GAGGCACGCTGTGCTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088976446 Original CRISPR TCCCAATGGCCTGTTTGTGC AGG (reversed) Intergenic
No off target data available for this crispr