ID: 1088979903

View in Genome Browser
Species Human (GRCh38)
Location 11:114852880-114852902
Sequence AGGATGCTATTGCATCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088979903_1088979911 29 Left 1088979903 11:114852880-114852902 CCCACTAGATGCAATAGCATCCT No data
Right 1088979911 11:114852932-114852954 AGACATTGCCAAGTGTCCCCTGG 0: 21
1: 209
2: 607
3: 1119
4: 1386
1088979903_1088979912 30 Left 1088979903 11:114852880-114852902 CCCACTAGATGCAATAGCATCCT No data
Right 1088979912 11:114852933-114852955 GACATTGCCAAGTGTCCCCTGGG 0: 12
1: 161
2: 564
3: 993
4: 1303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088979903 Original CRISPR AGGATGCTATTGCATCTAGT GGG (reversed) Intergenic
No off target data available for this crispr