ID: 1088979903 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:114852880-114852902 |
| Sequence | AGGATGCTATTGCATCTAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1088979903_1088979911 | 29 | Left | 1088979903 | 11:114852880-114852902 | CCCACTAGATGCAATAGCATCCT | No data | ||
| Right | 1088979911 | 11:114852932-114852954 | AGACATTGCCAAGTGTCCCCTGG | No data | ||||
| 1088979903_1088979912 | 30 | Left | 1088979903 | 11:114852880-114852902 | CCCACTAGATGCAATAGCATCCT | No data | ||
| Right | 1088979912 | 11:114852933-114852955 | GACATTGCCAAGTGTCCCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1088979903 | Original CRISPR | AGGATGCTATTGCATCTAGT GGG (reversed) | Intergenic | ||