ID: 1088981894

View in Genome Browser
Species Human (GRCh38)
Location 11:114871586-114871608
Sequence GGCTCGTGTAAAACGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088981890_1088981894 7 Left 1088981890 11:114871556-114871578 CCTGCTGTTAGCAAGGTCTCTCC No data
Right 1088981894 11:114871586-114871608 GGCTCGTGTAAAACGCCCTGTGG No data
1088981888_1088981894 20 Left 1088981888 11:114871543-114871565 CCTGCACATTACTCCTGCTGTTA No data
Right 1088981894 11:114871586-114871608 GGCTCGTGTAAAACGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088981894 Original CRISPR GGCTCGTGTAAAACGCCCTG TGG Intergenic
No off target data available for this crispr