ID: 1088982336

View in Genome Browser
Species Human (GRCh38)
Location 11:114875034-114875056
Sequence TCTGGGGCCCAGAGGCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088982336_1088982342 12 Left 1088982336 11:114875034-114875056 CCATGGAGCCTCTGGGCCCCAGA No data
Right 1088982342 11:114875069-114875091 TGTTGCCTGACACCTGTAACAGG No data
1088982336_1088982343 13 Left 1088982336 11:114875034-114875056 CCATGGAGCCTCTGGGCCCCAGA No data
Right 1088982343 11:114875070-114875092 GTTGCCTGACACCTGTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088982336 Original CRISPR TCTGGGGCCCAGAGGCTCCA TGG (reversed) Intergenic
No off target data available for this crispr