ID: 1088984381

View in Genome Browser
Species Human (GRCh38)
Location 11:114892661-114892683
Sequence CTGTGGTTTAGCAGCAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088984381_1088984389 16 Left 1088984381 11:114892661-114892683 CCAGGGTTGCTGCTAAACCACAG No data
Right 1088984389 11:114892700-114892722 ATAGAAAACAGGACTCCTACAGG No data
1088984381_1088984388 5 Left 1088984381 11:114892661-114892683 CCAGGGTTGCTGCTAAACCACAG No data
Right 1088984388 11:114892689-114892711 CCTGGTGCAAAATAGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088984381 Original CRISPR CTGTGGTTTAGCAGCAACCC TGG (reversed) Intergenic
No off target data available for this crispr