ID: 1088988473

View in Genome Browser
Species Human (GRCh38)
Location 11:114929767-114929789
Sequence TCCTCCCCAGGGTCAGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088988473_1088988480 -6 Left 1088988473 11:114929767-114929789 CCGACCCCTGACCCTGGGGAGGA No data
Right 1088988480 11:114929784-114929806 GGAGGAGACTGCCCTGGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088988473 Original CRISPR TCCTCCCCAGGGTCAGGGGT CGG (reversed) Intergenic
No off target data available for this crispr