ID: 1088992500

View in Genome Browser
Species Human (GRCh38)
Location 11:114966062-114966084
Sequence CTGGTTACTCACAGTTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088992495_1088992500 4 Left 1088992495 11:114966035-114966057 CCCGGGAACAGTGCTAGTCTCTT No data
Right 1088992500 11:114966062-114966084 CTGGTTACTCACAGTTTGGCAGG No data
1088992496_1088992500 3 Left 1088992496 11:114966036-114966058 CCGGGAACAGTGCTAGTCTCTTT No data
Right 1088992500 11:114966062-114966084 CTGGTTACTCACAGTTTGGCAGG No data
1088992492_1088992500 27 Left 1088992492 11:114966012-114966034 CCACTTATTGGCAGTATCGCTAT No data
Right 1088992500 11:114966062-114966084 CTGGTTACTCACAGTTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088992500 Original CRISPR CTGGTTACTCACAGTTTGGC AGG Intergenic
No off target data available for this crispr