ID: 1088993617

View in Genome Browser
Species Human (GRCh38)
Location 11:114976728-114976750
Sequence TAAGGGGCCCAGCCACATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088993609_1088993617 19 Left 1088993609 11:114976686-114976708 CCGAGTGCTGATTCTTGCTCAGG No data
Right 1088993617 11:114976728-114976750 TAAGGGGCCCAGCCACATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088993617 Original CRISPR TAAGGGGCCCAGCCACATCT GGG Intergenic
No off target data available for this crispr