ID: 1088996148

View in Genome Browser
Species Human (GRCh38)
Location 11:114999042-114999064
Sequence ATGCAGAGCCAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088996137_1088996148 26 Left 1088996137 11:114998993-114999015 CCATGAGAAAGCAGAAGCCGCCA No data
Right 1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG No data
1088996144_1088996148 -8 Left 1088996144 11:114999027-114999049 CCATTGGGGACAGAGATGCAGAG No data
Right 1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG No data
1088996139_1088996148 9 Left 1088996139 11:114999010-114999032 CCGCCAGTTAATGGAAGCCATTG No data
Right 1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG No data
1088996142_1088996148 6 Left 1088996142 11:114999013-114999035 CCAGTTAATGGAAGCCATTGGGG No data
Right 1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088996148 Original CRISPR ATGCAGAGCCAGGAGGAGGA AGG Intergenic
No off target data available for this crispr