ID: 1089002318

View in Genome Browser
Species Human (GRCh38)
Location 11:115062054-115062076
Sequence GATTCTCTTTGAGGTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089002318_1089002325 19 Left 1089002318 11:115062054-115062076 CCAGCTTGACCTCAAAGAGAATC No data
Right 1089002325 11:115062096-115062118 AGCTTAGGGTCACTCAAGTTAGG No data
1089002318_1089002326 20 Left 1089002318 11:115062054-115062076 CCAGCTTGACCTCAAAGAGAATC No data
Right 1089002326 11:115062097-115062119 GCTTAGGGTCACTCAAGTTAGGG No data
1089002318_1089002327 24 Left 1089002318 11:115062054-115062076 CCAGCTTGACCTCAAAGAGAATC No data
Right 1089002327 11:115062101-115062123 AGGGTCACTCAAGTTAGGGACGG No data
1089002318_1089002328 28 Left 1089002318 11:115062054-115062076 CCAGCTTGACCTCAAAGAGAATC No data
Right 1089002328 11:115062105-115062127 TCACTCAAGTTAGGGACGGTAGG No data
1089002318_1089002320 -4 Left 1089002318 11:115062054-115062076 CCAGCTTGACCTCAAAGAGAATC No data
Right 1089002320 11:115062073-115062095 AATCTACTGCTCATATCCCAAGG No data
1089002318_1089002322 5 Left 1089002318 11:115062054-115062076 CCAGCTTGACCTCAAAGAGAATC No data
Right 1089002322 11:115062082-115062104 CTCATATCCCAAGGAGCTTAGGG No data
1089002318_1089002321 4 Left 1089002318 11:115062054-115062076 CCAGCTTGACCTCAAAGAGAATC No data
Right 1089002321 11:115062081-115062103 GCTCATATCCCAAGGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089002318 Original CRISPR GATTCTCTTTGAGGTCAAGC TGG (reversed) Intergenic
No off target data available for this crispr