ID: 1089002885

View in Genome Browser
Species Human (GRCh38)
Location 11:115067040-115067062
Sequence CCTCAGGAGCAGACAGTGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089002885_1089002891 22 Left 1089002885 11:115067040-115067062 CCGTACACTGTCTGCTCCTGAGG No data
Right 1089002891 11:115067085-115067107 GAAGCATGAGACCTTCTGACTGG No data
1089002885_1089002888 -4 Left 1089002885 11:115067040-115067062 CCGTACACTGTCTGCTCCTGAGG No data
Right 1089002888 11:115067059-115067081 GAGGCTGTTCTACCTCTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089002885 Original CRISPR CCTCAGGAGCAGACAGTGTA CGG (reversed) Intergenic
No off target data available for this crispr