ID: 1089003093

View in Genome Browser
Species Human (GRCh38)
Location 11:115068469-115068491
Sequence TGCCCCCACCCAGTTGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089003093_1089003096 1 Left 1089003093 11:115068469-115068491 CCAAAAACAACTGGGTGGGGGCA No data
Right 1089003096 11:115068493-115068515 GGATGAGCCCAGGACACTGATGG No data
1089003093_1089003100 13 Left 1089003093 11:115068469-115068491 CCAAAAACAACTGGGTGGGGGCA No data
Right 1089003100 11:115068505-115068527 GACACTGATGGAGCCCTCCTGGG No data
1089003093_1089003095 -9 Left 1089003093 11:115068469-115068491 CCAAAAACAACTGGGTGGGGGCA No data
Right 1089003095 11:115068483-115068505 GTGGGGGCATGGATGAGCCCAGG No data
1089003093_1089003099 12 Left 1089003093 11:115068469-115068491 CCAAAAACAACTGGGTGGGGGCA No data
Right 1089003099 11:115068504-115068526 GGACACTGATGGAGCCCTCCTGG No data
1089003093_1089003105 30 Left 1089003093 11:115068469-115068491 CCAAAAACAACTGGGTGGGGGCA No data
Right 1089003105 11:115068522-115068544 CCTGGGCAGAACCCACAGCAGGG No data
1089003093_1089003103 29 Left 1089003093 11:115068469-115068491 CCAAAAACAACTGGGTGGGGGCA No data
Right 1089003103 11:115068521-115068543 TCCTGGGCAGAACCCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089003093 Original CRISPR TGCCCCCACCCAGTTGTTTT TGG (reversed) Intergenic