ID: 1089003099

View in Genome Browser
Species Human (GRCh38)
Location 11:115068504-115068526
Sequence GGACACTGATGGAGCCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089003093_1089003099 12 Left 1089003093 11:115068469-115068491 CCAAAAACAACTGGGTGGGGGCA No data
Right 1089003099 11:115068504-115068526 GGACACTGATGGAGCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089003099 Original CRISPR GGACACTGATGGAGCCCTCC TGG Intergenic