ID: 1089004034

View in Genome Browser
Species Human (GRCh38)
Location 11:115075772-115075794
Sequence CTGTGGGTATAGGGTCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089004025_1089004034 6 Left 1089004025 11:115075743-115075765 CCAAATCCTCTCTTAAGTAAATG No data
Right 1089004034 11:115075772-115075794 CTGTGGGTATAGGGTCAAGATGG No data
1089004029_1089004034 0 Left 1089004029 11:115075749-115075771 CCTCTCTTAAGTAAATGGGGTAG No data
Right 1089004034 11:115075772-115075794 CTGTGGGTATAGGGTCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089004034 Original CRISPR CTGTGGGTATAGGGTCAAGA TGG Intergenic
No off target data available for this crispr