ID: 1089004126

View in Genome Browser
Species Human (GRCh38)
Location 11:115076650-115076672
Sequence AGGGTGAGACAGTTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089004126_1089004132 14 Left 1089004126 11:115076650-115076672 CCTTCCTCAAACTGTCTCACCCT No data
Right 1089004132 11:115076687-115076709 ACCATTCTCTTGAGCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089004126 Original CRISPR AGGGTGAGACAGTTTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr