ID: 1089005537

View in Genome Browser
Species Human (GRCh38)
Location 11:115087728-115087750
Sequence CAGGCTGGGGCTTCTCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089005528_1089005537 6 Left 1089005528 11:115087699-115087721 CCTTCTTCGGTAAAACAAGTTCA No data
Right 1089005537 11:115087728-115087750 CAGGCTGGGGCTTCTCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089005537 Original CRISPR CAGGCTGGGGCTTCTCGGGG AGG Intergenic
No off target data available for this crispr