ID: 1089009239

View in Genome Browser
Species Human (GRCh38)
Location 11:115119273-115119295
Sequence CTGGCCCAAGGGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089009227_1089009239 20 Left 1089009227 11:115119230-115119252 CCCAGGATCAAAGGACTTCTCTA No data
Right 1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG No data
1089009228_1089009239 19 Left 1089009228 11:115119231-115119253 CCAGGATCAAAGGACTTCTCTAG No data
Right 1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG No data
1089009225_1089009239 30 Left 1089009225 11:115119220-115119242 CCAGTGAGTACCCAGGATCAAAG No data
Right 1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089009239 Original CRISPR CTGGCCCAAGGGAAGGGGGA GGG Intergenic
No off target data available for this crispr