ID: 1089014724

View in Genome Browser
Species Human (GRCh38)
Location 11:115156663-115156685
Sequence TGCTGCTGGTCAGCAAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089014724_1089014731 25 Left 1089014724 11:115156663-115156685 CCTTCATTTGCTGACCAGCAGCA No data
Right 1089014731 11:115156711-115156733 TGGCCAGCTATTAAGGGATGGGG No data
1089014724_1089014727 18 Left 1089014724 11:115156663-115156685 CCTTCATTTGCTGACCAGCAGCA No data
Right 1089014727 11:115156704-115156726 GAAACTGTGGCCAGCTATTAAGG No data
1089014724_1089014729 23 Left 1089014724 11:115156663-115156685 CCTTCATTTGCTGACCAGCAGCA No data
Right 1089014729 11:115156709-115156731 TGTGGCCAGCTATTAAGGGATGG No data
1089014724_1089014728 19 Left 1089014724 11:115156663-115156685 CCTTCATTTGCTGACCAGCAGCA No data
Right 1089014728 11:115156705-115156727 AAACTGTGGCCAGCTATTAAGGG No data
1089014724_1089014730 24 Left 1089014724 11:115156663-115156685 CCTTCATTTGCTGACCAGCAGCA No data
Right 1089014730 11:115156710-115156732 GTGGCCAGCTATTAAGGGATGGG No data
1089014724_1089014726 5 Left 1089014724 11:115156663-115156685 CCTTCATTTGCTGACCAGCAGCA No data
Right 1089014726 11:115156691-115156713 ATCTGCAACAGCAGAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089014724 Original CRISPR TGCTGCTGGTCAGCAAATGA AGG (reversed) Intergenic
No off target data available for this crispr