ID: 1089016920

View in Genome Browser
Species Human (GRCh38)
Location 11:115172909-115172931
Sequence CTGAGGGGATGGTGGGAAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 533}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089016907_1089016920 21 Left 1089016907 11:115172865-115172887 CCATGACGTGGCCAAGGGAGAAA 0: 1
1: 0
2: 2
3: 17
4: 123
Right 1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG 0: 1
1: 0
2: 1
3: 53
4: 533
1089016905_1089016920 23 Left 1089016905 11:115172863-115172885 CCCCATGACGTGGCCAAGGGAGA 0: 1
1: 0
2: 3
3: 7
4: 96
Right 1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG 0: 1
1: 0
2: 1
3: 53
4: 533
1089016911_1089016920 10 Left 1089016911 11:115172876-115172898 CCAAGGGAGAAAAGGGGAACTCA 0: 1
1: 0
2: 1
3: 29
4: 290
Right 1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG 0: 1
1: 0
2: 1
3: 53
4: 533
1089016906_1089016920 22 Left 1089016906 11:115172864-115172886 CCCATGACGTGGCCAAGGGAGAA 0: 1
1: 0
2: 1
3: 12
4: 99
Right 1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG 0: 1
1: 0
2: 1
3: 53
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089016920 Original CRISPR CTGAGGGGATGGTGGGAAAA GGG Exonic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900512490 1:3067238-3067260 GTGTGGGGAGGGTGGGTAAAGGG + Intergenic
901159230 1:7162454-7162476 TGGAGGGGCTGGGGGGAAAAGGG - Intronic
901251157 1:7781545-7781567 GAGAGGGGCTGGTGAGAAAAGGG - Intergenic
901435190 1:9243190-9243212 CAGAGGGGGTGGTGGGAGGAGGG + Intronic
901466591 1:9425624-9425646 TTGGGGGGATGTTGGGAGAAGGG - Intergenic
901587819 1:10312920-10312942 CTGAGTGGATGGATGGATAATGG + Intronic
902126142 1:14213311-14213333 CGGAGGGGATGGGAGGAAGAGGG - Intergenic
903002398 1:20275569-20275591 CTGAGGGGAGGAGGGGAAGAGGG + Intergenic
903269542 1:22178734-22178756 CAGAGGAGATGGTGGGGAACAGG - Intergenic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904617284 1:31756647-31756669 CCGAGGCGATGGTAGGAAAGAGG + Exonic
904877818 1:33670151-33670173 CTGAGGGGATGGGGAGGACAAGG - Intronic
906119878 1:43382308-43382330 GTGAGAGGGGGGTGGGAAAAGGG + Intergenic
906128522 1:43442199-43442221 CAGAGGGGAGGGTGGGATCAAGG + Intronic
906408949 1:45563903-45563925 CTGAGGGGAGTCTGGGAATATGG + Intronic
907417634 1:54325441-54325463 AGGAGTGGAAGGTGGGAAAAAGG + Intronic
907520667 1:55021502-55021524 CTGAGAGGCTGGCAGGAAAAAGG + Intergenic
907864894 1:58390092-58390114 CTGAGGGGAGGCTGGGGGAAGGG + Intronic
907880835 1:58547993-58548015 CTGAGGGGATAGTGAGATGATGG - Intergenic
909094831 1:71273635-71273657 TGGAGGGAATGGTGAGAAAAAGG + Intergenic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909843667 1:80362518-80362540 ATGGGGGGAAGGTGGGAAGAGGG - Intergenic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910681551 1:89870674-89870696 CTGAGGGGAAGGTGGGGAGGGGG - Intronic
910703260 1:90100114-90100136 CTGAGTGGCTGGGAGGAAAAGGG + Intergenic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
911183451 1:94881352-94881374 CTGAGGAAATGGTGGGAGAGAGG - Intronic
911313920 1:96332839-96332861 TTGAGGAGATGTTGGGCAAATGG - Intergenic
911735478 1:101331979-101332001 GTGAGTGGAAGGTGAGAAAATGG + Intergenic
913094934 1:115507448-115507470 CTGAGGGGAAAGGGGAAAAAGGG - Intergenic
913177964 1:116292286-116292308 TGCAGGAGATGGTGGGAAAATGG - Intergenic
913262338 1:117010900-117010922 CTGAGGATGTGGTGGGAAAGAGG - Intronic
913338344 1:117732115-117732137 ATGAGGAGATGCTGGGAAGAAGG + Intergenic
914433972 1:147643639-147643661 GGGATGGGATGATGGGAAAAAGG + Exonic
914455609 1:147833630-147833652 CTCAGGGGAGGGTGGGAATCTGG - Intergenic
914814747 1:151055217-151055239 CTAAGGGCCTGGTGGGAAGAGGG + Intronic
915312501 1:155011549-155011571 CTGGGGGGGTGGCGGGAAAGAGG + Intronic
915420059 1:155773329-155773351 TTGGGGGGATGGTGGGCAGATGG - Intronic
915576032 1:156778183-156778205 CTGAGGAGACGATGGTAAAAGGG - Intronic
915952244 1:160197358-160197380 GAGAGGGGAGGGTGGGCAAAGGG - Intronic
916473132 1:165143029-165143051 GAGTGGGGATGGTGGTAAAAGGG + Intergenic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
918033031 1:180835486-180835508 CTAAGGGGGGGGTGCGAAAACGG - Intronic
918635449 1:186768822-186768844 TTGAGGTGGTGGTGGAAAAAAGG + Intergenic
918766164 1:188486492-188486514 CTCAGGGGGTGGTGGGCAAGGGG + Intergenic
919508966 1:198436680-198436702 AAAAGGGGTTGGTGGGAAAAAGG - Intergenic
919621167 1:199866089-199866111 CTGAGCGGCAGGTGGGAAATTGG - Intergenic
920920123 1:210291974-210291996 GTGGGGGGAGGATGGGAAAAAGG + Intergenic
921331367 1:214041054-214041076 TTGTGGGGAGGGTGGGAAAGGGG + Exonic
922504144 1:226116728-226116750 CTGAGGTGCTGCAGGGAAAATGG + Intergenic
922598360 1:226831202-226831224 CTGTGGGGATAGTGGGCACATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063102190 10:2960038-2960060 GTCAGGGGATGGGGGGCAAACGG + Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1065607908 10:27439840-27439862 CTCAGTGGTTGGTGGGGAAAAGG - Intergenic
1065662238 10:28018065-28018087 CAGAAGGGATTCTGGGAAAAAGG - Intergenic
1065817530 10:29495601-29495623 CTGAGGGGAGGGAGGGACAGTGG + Intronic
1065955331 10:30688797-30688819 CTGAGGGGAGGGAGGGACAGTGG - Intergenic
1066459509 10:35600962-35600984 CTCCAGGGCTGGTGGGAAAAGGG - Intergenic
1066577219 10:36839359-36839381 GTGAGGGGATGCTGGTGAAATGG + Intergenic
1066795139 10:39111920-39111942 ATGGGGGCATGTTGGGAAAAAGG + Intergenic
1067334862 10:45352679-45352701 GTGAGGCGTGGGTGGGAAAAAGG - Intergenic
1069436956 10:68393009-68393031 TTGAGGGGATAGAGAGAAAATGG - Intronic
1069582945 10:69577649-69577671 CTGAGGGGATGGTGGAGGCAGGG + Intergenic
1070888856 10:79927390-79927412 CTGATGGGCTGCTGGGAAGAGGG + Intergenic
1071329798 10:84548187-84548209 ATGAGAGGCTGATGGGAAAAAGG - Intergenic
1071679171 10:87687184-87687206 CTGTGGGGATAGTGGTGAAAGGG - Intronic
1072012729 10:91317722-91317744 GTTAGGGGATGATGGGAAATTGG + Intergenic
1072719193 10:97770537-97770559 CTGAGGGGTGGGTGGGAGGAGGG + Intronic
1074065982 10:110014297-110014319 CTAAGGAGGTGGTTGGAAAATGG + Intronic
1074210699 10:111331537-111331559 CTGAGGAGATGGAGGGAGACAGG - Intergenic
1074473148 10:113745451-113745473 GTGATGGGCTGGTGGGAAAGAGG + Intergenic
1074778845 10:116785869-116785891 GTGAGGGGAGGGGGGGAAATAGG - Intergenic
1075210712 10:120488751-120488773 CTGAGGTGAGGGTGGGACAATGG - Intronic
1076114566 10:127886406-127886428 CTCAGGGGCTGCTGGCAAAAGGG + Intronic
1076285103 10:129287822-129287844 ATGTGGGGAAGGTGGGGAAAGGG + Intergenic
1076328529 10:129647014-129647036 CTGAGCGGCTGGGAGGAAAATGG - Intronic
1076699577 10:132264520-132264542 CAGAGGGGATGGTGAAAGAACGG + Intronic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077894527 11:6443685-6443707 CTGAGAGGAGTGTGGGACAAAGG - Intergenic
1078344396 11:10532436-10532458 GTTGGGAGATGGTGGGAAAAGGG - Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079001247 11:16758748-16758770 CAGAGGGGGTGGTGGGAACCAGG - Intergenic
1079023318 11:16925908-16925930 CTGAGGAGGGGGAGGGAAAAGGG + Intronic
1079414074 11:20216559-20216581 GTGAGTGGCAGGTGGGAAAATGG - Intergenic
1079477657 11:20848307-20848329 GTCAGGGGATGGTGGGACCAGGG + Intronic
1079733268 11:23962328-23962350 CTGAGAGGATGGAGAGACAACGG + Intergenic
1081081060 11:38739888-38739910 GTCAGGGGATGGGGGGAAAGGGG - Intergenic
1081594124 11:44447439-44447461 CTGAAGGGCTGATGGGAAACAGG + Intergenic
1081751638 11:45515341-45515363 GTGAGGGGATGGGTGGCAAATGG + Intergenic
1082269561 11:50155262-50155284 CTGAGGGGATGGGGAGGAAGGGG - Intergenic
1082328935 11:51185809-51185831 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082335294 11:51278123-51278145 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082343172 11:51392886-51392908 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082361749 11:51663062-51663084 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082389693 11:52069527-52069549 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082400959 11:52232884-52232906 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082423307 11:52555924-52555946 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082443547 11:52848286-52848308 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082445964 11:52883145-52883167 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082482015 11:53405343-53405365 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082482432 11:53411293-53411315 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082510355 11:53814351-53814373 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082512072 11:53839011-53839033 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082545403 11:54321433-54321455 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082799275 11:57402409-57402431 CTGAGGGGCTGGCAGGAAAAAGG + Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083299377 11:61732315-61732337 CTGGAGGGATGGTGAGAATAAGG - Intronic
1083369178 11:62164905-62164927 CTGCGGGAATGGTAGGGAAAGGG + Intergenic
1083562302 11:63682182-63682204 TTGAGGGGATGGTGGTGAAAGGG + Intronic
1083735386 11:64677340-64677362 GGGAGGGGATGGTGGGGAAGAGG - Intronic
1084331391 11:68432658-68432680 AGGAGGGGATGCTGGGAAATCGG - Intronic
1084507016 11:69574725-69574747 CTGAGTGGATGGTGGGAGGGAGG - Intergenic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085395314 11:76204226-76204248 TAGAGGGGGAGGTGGGAAAAGGG - Intronic
1085608831 11:77928075-77928097 CTGAGGTGAGGTTGGGAAGAAGG - Intronic
1085665633 11:78413575-78413597 CTGAGAAGAAGGTGGGAGAAAGG + Intronic
1087206561 11:95402247-95402269 TTGATGGGATGCTGTGAAAAGGG - Intergenic
1087235410 11:95712715-95712737 CAAAGTGGGTGGTGGGAAAATGG + Intergenic
1087509543 11:99073544-99073566 GTCAGGGGATGGGGGGACAAGGG - Intronic
1087903703 11:103671333-103671355 CTCAGGGGATTGTGGGGAGAGGG - Intergenic
1088824697 11:113483820-113483842 CTGAGGGAAGGCTGGGAACATGG - Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089882968 11:121792501-121792523 TTGAGTGGAAGGTGGGCAAAGGG + Intergenic
1090333973 11:125950742-125950764 CTGAGGGGCTGGTGAGGAACAGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1091736558 12:2927026-2927048 CTGAGGGGATTGGAGGGAAATGG - Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092367037 12:7884878-7884900 CTGAGGGTAGGGTGGGAAAGAGG + Intronic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093780878 12:23135990-23136012 TTGGGGGGATGGTAGGAGAAGGG - Intergenic
1094386554 12:29900719-29900741 CTGAAAGGAAGGTGGGAAACTGG + Intergenic
1094777193 12:33744420-33744442 ATGAGGGGATGTTGGTCAAAGGG + Intergenic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1096046469 12:48566975-48566997 TGGAGGGGATGTTGGGAAAAAGG - Intergenic
1096155499 12:49339331-49339353 GTGAGTGGAGGGAGGGAAAAGGG - Intergenic
1096525639 12:52208388-52208410 CCTATGGGATGGTGGGATAAAGG + Intergenic
1096716991 12:53497615-53497637 CTGAGGTGATGCTGGGAAGAAGG - Intronic
1096876995 12:54637107-54637129 GAGATGGGAGGGTGGGAAAAGGG + Intergenic
1096938335 12:55309006-55309028 GTCAGGGGGTGGTGGGAAAGGGG + Intergenic
1097046107 12:56189063-56189085 CTGAGGGGAAGGTGGGCTAATGG + Intronic
1097952191 12:65443863-65443885 GCCAGGGGATGGTGGGAAGATGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1100552035 12:95654831-95654853 ATGATGGGATGTTGGGATAATGG + Intergenic
1100552093 12:95655063-95655085 ATGATGGGATGTTGGGATAATGG + Intergenic
1100552175 12:95655399-95655421 ATGATGGGATGTTGGGATAATGG + Intergenic
1100615350 12:96227331-96227353 CAGAAGAGATGATGGGAAAAAGG - Intronic
1101028110 12:100633758-100633780 CTGAGGCCATGTTTGGAAAATGG - Intergenic
1101322162 12:103682148-103682170 CTGATGGGAAGATGGGAAGATGG + Intronic
1101811198 12:108109432-108109454 GTCAGGGGCTGGGGGGAAAAGGG - Intergenic
1102234703 12:111287078-111287100 CAGAGAGGCTGGTGGGAACAGGG - Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1103147637 12:118609344-118609366 TTGAGGGGAAGGAGGGAAAGAGG + Intergenic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103187456 12:118971857-118971879 CTGAGGAGAGGGAGGGAATAGGG + Intergenic
1104600076 12:130147253-130147275 CTGAGTGGCTAGTGGGCAAAGGG - Intergenic
1105790313 13:23791856-23791878 TTGAGTGGTTGGTGGGACAAAGG - Intronic
1106356887 13:28991763-28991785 CAAAGGGGAAGGAGGGAAAAAGG - Intronic
1106890236 13:34237004-34237026 ATGAGGAGATGGTGGTCAAAGGG - Intergenic
1107878363 13:44810284-44810306 CAGAGGGGAGGGTGTGGAAATGG - Intergenic
1107966488 13:45602796-45602818 CTCAGAGCAGGGTGGGAAAATGG - Intronic
1108489153 13:50962930-50962952 CTGAGGGGATAGGGAGAAAAGGG - Intronic
1108502971 13:51084829-51084851 CAGAGGAGATGGTGGTAAGATGG + Intergenic
1109653633 13:65361565-65361587 CTCAGGGGAGGGTGGAAAAATGG + Intergenic
1110265808 13:73536155-73536177 CTGAGGAGTTGCTGGGAGAAAGG - Intergenic
1110868038 13:80420087-80420109 ATGAGGAGATGGGGGGAGAAGGG - Intergenic
1112855098 13:103759039-103759061 ATGAGAGGAGAGTGGGAAAAAGG + Intergenic
1113522457 13:110950523-110950545 CTGAGGGCATGGTGGGCATGAGG - Intergenic
1113600250 13:111563375-111563397 GTGAGGGGAGGGAGGGAAAGAGG - Intergenic
1113600276 13:111563450-111563472 GTGAGGGGAGGGAGGGAAACAGG - Intergenic
1113949946 13:114066330-114066352 GTGAGGCCCTGGTGGGAAAAGGG + Intronic
1115013408 14:28578782-28578804 CACTGGGGAGGGTGGGAAAAGGG - Intergenic
1115508818 14:34119769-34119791 CTGAAGGGAAGGGGGGTAAAGGG + Intronic
1116088006 14:40266294-40266316 CTGAGGGGATGTGGAGAAATAGG + Intergenic
1116464468 14:45215108-45215130 CTGAAATGATGGTGGGATAAAGG + Intronic
1117234578 14:53757997-53758019 CTGGGGGGGTTGTGAGAAAAGGG + Intergenic
1117732708 14:58739911-58739933 AGGAGAGGATGGTGGGAAGAAGG + Intergenic
1118027918 14:61789604-61789626 TAGAGGGGCTGGTGTGAAAAAGG + Intronic
1118768340 14:68925084-68925106 CTTAAGGGATGGTGGCAGAAAGG + Intronic
1118785747 14:69044138-69044160 CTGAGGGGAGGAGGGGAAAGAGG + Intergenic
1119236962 14:73027508-73027530 CTGAGGGAATGGTGTGCAAGAGG - Intergenic
1119889613 14:78173115-78173137 ATGAGAGAATGGTGGGAGAACGG + Intergenic
1120333256 14:83120718-83120740 CAGAAGGCATGTTGGGAAAATGG - Intergenic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121242417 14:92440247-92440269 CTGAGGGGATGTGGGGTAAGGGG - Intronic
1121695848 14:95911269-95911291 CTCAGCTGATGGTGGGAGAAGGG - Intergenic
1122053483 14:99075998-99076020 CAGAAGGGAGAGTGGGAAAAGGG - Intergenic
1122915586 14:104856900-104856922 GTGAGAGGAGGGAGGGAAAAAGG - Intergenic
1123632887 15:22274459-22274481 CTTAGGGGTTGGGGGAAAAAAGG - Intergenic
1124234027 15:27971169-27971191 CGCATGGCATGGTGGGAAAACGG + Intronic
1124683178 15:31755122-31755144 ATGAAGGGAAGGTGGGAAGAGGG + Intronic
1126358005 15:47816601-47816623 CAGAGGGGATTGTGGGAATCAGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126663352 15:51053585-51053607 CTGAGGGCAAGGTGGGGAGAAGG - Intergenic
1127274091 15:57427026-57427048 CTGAGGGGCTGGTGAGAGCAAGG + Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1128660968 15:69500773-69500795 CTGAGTGGATGGTGAGAGCATGG + Intergenic
1129590220 15:76908196-76908218 CTGAGAGAATTGAGGGAAAATGG - Intergenic
1129709698 15:77814314-77814336 CTGAGGGCACGGTGGGAAGTGGG - Intronic
1129814769 15:78541658-78541680 CCGGGGGTAGGGTGGGAAAAGGG - Intronic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1130520035 15:84655079-84655101 TTTAGGGGATGGGAGGAAAAGGG - Intergenic
1130539124 15:84809268-84809290 GGGAGGTGATGGTGGGAAAAGGG + Intergenic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1131205254 15:90439888-90439910 ATGAGGGGTTGGGGAGAAAAAGG + Intronic
1131571152 15:93537793-93537815 CTGAAGGGATCGGGAGAAAAAGG - Intergenic
1131731540 15:95287120-95287142 TTGAGGGGAGGGTGCAAAAAAGG + Intergenic
1132776367 16:1597007-1597029 CTAAGGGGCTGATGGGAAAGTGG + Intronic
1133013949 16:2930398-2930420 CTGAGGGGCTGCTGGGGGAACGG - Exonic
1133148374 16:3807807-3807829 CAGAGGGGCTGGTGGGAAAGTGG - Intronic
1133524261 16:6588996-6589018 ATGAAGGGATGATGGAAAAAAGG - Intronic
1133819965 16:9227265-9227287 CTGCGGGGGTGGGGGTAAAATGG + Intergenic
1134663912 16:16004437-16004459 CTGAGGTGATGGCTGAAAAAAGG - Intronic
1134784835 16:16932655-16932677 TTGAGGGGATAGAGGGAACATGG - Intergenic
1134841561 16:17405828-17405850 CTGAGGGCAGGGAGGGGAAATGG - Intronic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1137786318 16:51140457-51140479 CTGGGGGGCTGGTGGCAGAATGG + Exonic
1138191279 16:55016182-55016204 GTGGGGGGGTGTTGGGAAAAGGG + Intergenic
1138492747 16:57385913-57385935 TGGAGGGGATGGTAGGAAACGGG - Intergenic
1138493092 16:57388355-57388377 CTGAGGCGGGGGTGGGAGAATGG - Intergenic
1139065615 16:63310006-63310028 CCGAAGGGGTGGTGGGAAAGGGG - Intergenic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140791638 16:78397738-78397760 CTGAGGTGATCCTGAGAAAAAGG - Intronic
1140802696 16:78503214-78503236 CTGAGAGCATGATGGGAAGATGG + Intronic
1141288813 16:82698354-82698376 CTCTGTAGATGGTGGGAAAAAGG + Intronic
1141611958 16:85186953-85186975 CTGAGGGGCTGGTGGGAAAGAGG - Intergenic
1141970174 16:87476308-87476330 CTTAGGGGTTGGGGGAAAAAAGG + Intronic
1142325438 16:89411886-89411908 CTGAGGGGAGGGATGGAACATGG - Intronic
1142341052 16:89522849-89522871 AGGAGGGCATGGTGGGGAAAAGG - Intronic
1142414577 16:89934452-89934474 CTGAGGGGATCCTGGGTGAATGG - Intronic
1142698615 17:1646684-1646706 GGCAGGGGATGGTGAGAAAAGGG + Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1143367776 17:6419659-6419681 GTCAGGGGATGGGGGGAAAGGGG + Intronic
1143444399 17:6998827-6998849 CTGAAGGCAGGGTGAGAAAAAGG + Exonic
1143452811 17:7046170-7046192 CTGATGGGAGGCTGGCAAAAGGG - Intergenic
1143728272 17:8865243-8865265 CTGGGGGGATGGGGGCACAAGGG - Intronic
1144077150 17:11729649-11729671 TTGAGGGGAGGGTGGCAGAAGGG + Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1145319036 17:21752536-21752558 CTGAAGGGATGCCAGGAAAAGGG - Intergenic
1146466955 17:33094000-33094022 CAGAGGAGAGGGTGGGACAATGG + Intronic
1146988674 17:37246773-37246795 GGGAGGGGAAGGTAGGAAAAGGG - Intronic
1147421657 17:40324866-40324888 CTGTGGGGTTGGTGGGGAAGAGG + Intronic
1147472676 17:40677598-40677620 CTAAGGGGCTGGTGGGACGACGG - Intergenic
1147487612 17:40832550-40832572 TTGAGGGGTTTGTGGGAAACAGG - Intronic
1148086528 17:44996926-44996948 GAGAGGGGATGGTGGGAACACGG + Intergenic
1148243486 17:46014969-46014991 GTGAGGGGATGGTGGGGGGATGG + Intronic
1148353643 17:46959138-46959160 CTGATGAGATGGTGGGAAGTAGG + Intronic
1149571681 17:57676715-57676737 GTGGGTGGATGGTGGGAAACGGG - Intronic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1150142789 17:62744166-62744188 AAGAGAGGCTGGTGGGAAAAGGG - Intronic
1150822920 17:68450247-68450269 CTGAGGACGTGGTGGGAGAAGGG + Intronic
1151027845 17:70700051-70700073 CAGATGTGATGGAGGGAAAATGG - Intergenic
1151224561 17:72638982-72639004 CTGTGGGGATGCTGGGATACAGG + Intergenic
1151893558 17:76965348-76965370 GGGAAGGGAAGGTGGGAAAATGG + Intergenic
1152369971 17:79880706-79880728 TTGGAGGGAAGGTGGGAAAATGG + Intergenic
1154982014 18:21510357-21510379 CTGAGGGGAGGGAGGGAATGGGG - Intronic
1155488245 18:26370670-26370692 CTGAGGGGATGGTGTGGGAATGG + Intronic
1156267698 18:35503513-35503535 CTGAGGAGTAGGGGGGAAAAGGG - Intergenic
1157147509 18:45179351-45179373 CTGAGGCCATGGTGGGAGAGAGG - Intergenic
1157194521 18:45610076-45610098 GAGAGGGGATGGTGGGAGAGGGG - Intronic
1158037254 18:53048267-53048289 CTGAGTGGAGGGTGGGAGAAGGG - Intronic
1158091233 18:53716156-53716178 GTCAGGGGCTGGTGGGCAAAGGG - Intergenic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1160118961 18:76109816-76109838 GTGAGGGCACAGTGGGAAAATGG - Intergenic
1160598091 18:79991277-79991299 CTGAGGGAATGGGAGGGAAATGG - Intronic
1160612825 18:80101769-80101791 TTGAGGTGATGGTGAGAAGATGG + Intergenic
1160613987 18:80109774-80109796 CTGAGGGGAGAGTAGGAATAGGG + Intronic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160837986 19:1133402-1133424 CTGAGGGGAGAGTGGGACCAGGG + Intronic
1161398710 19:4058441-4058463 CCGAGGGGAAGGCGGAAAAAAGG - Intronic
1161575257 19:5051378-5051400 CTGATGGGTTGGGGGCAAAAGGG - Intronic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1162374516 19:10296737-10296759 TTGAGGGGATGGGTAGAAAATGG - Exonic
1163207955 19:15817711-15817733 CTGGGAGGATGCTGAGAAAAGGG - Intergenic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163549409 19:17957224-17957246 GGGAGGGGATGGTGGGGAAGGGG + Intronic
1163578081 19:18122331-18122353 CTGAGGGCATGGTCGCAAATGGG + Intronic
1164157934 19:22607751-22607773 CTGATGGGGCAGTGGGAAAAAGG - Intergenic
1164976184 19:32574427-32574449 ATGAGGGGAGGGAGGGAAATTGG - Intergenic
1165148838 19:33749441-33749463 GTGGGGGGATGGTGGGGAGATGG - Intronic
1165339950 19:35204231-35204253 CTGAGGGGAGGCTAGGAAGAGGG + Intergenic
1165766741 19:38356383-38356405 CGGAGGGGCTGGTGGGCATAAGG + Intronic
1165929127 19:39344671-39344693 CTGAAGGGATAATGGGAAAAGGG - Intronic
1166022520 19:40045328-40045350 CTGAGAGGATGAGGGAAAAAGGG + Intronic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166552602 19:43676390-43676412 CTGAGCTGATGGTAGGGAAAGGG + Intergenic
1167067523 19:47197981-47198003 GTGAGAGGATGCTGGGAACATGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168243049 19:55096737-55096759 CTGCGGGGAAGGTGTGAAGACGG - Intronic
1168251243 19:55143470-55143492 CTTAGGGGATGCTGGGCAAGGGG + Intronic
925132217 2:1502066-1502088 CCCAGGGGATGGAGAGAAAATGG + Intronic
925357357 2:3251300-3251322 CTAAAGGGAGGGTGGGAAGAGGG + Intronic
925425769 2:3747761-3747783 CTGAGGGGATGGGGTGAGTATGG + Intronic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926635388 2:15173611-15173633 CTGATGGTATGCTGAGAAAATGG - Intronic
926940586 2:18132031-18132053 CTGAGGGGGAGGTGGGAATGGGG + Intronic
927036016 2:19177322-19177344 CTGAGGGCCAGGTGTGAAAAAGG + Intergenic
927282967 2:21326857-21326879 CTGAGGGGATGGTGTGTAGATGG - Intergenic
928625537 2:33135966-33135988 CTGGGGGGGTGGTAGGAGAAGGG + Intronic
929083625 2:38146749-38146771 CTGCGGGGGTGGCGGGAGAAGGG - Intergenic
929826244 2:45311242-45311264 CTGAGGGGATTCGGGGAGAATGG - Intergenic
930033117 2:47070190-47070212 GGGAGGGGATGAGGGGAAAAGGG - Intronic
930202624 2:48559719-48559741 CTGGTGGTATGGTAGGAAAAGGG - Intronic
931090674 2:58882715-58882737 GTTGGGGGATGGGGGGAAAAGGG + Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931568128 2:63638155-63638177 ATGAAGAGATGGTGGGCAAAGGG + Intronic
931849257 2:66236295-66236317 CTGAGGGGGGGGGGGTAAAAGGG + Intergenic
932006903 2:67936527-67936549 CTGGGGGGATGGGGGGCTAAGGG + Intergenic
933715736 2:85358820-85358842 CTGAGTGGCTGGGGGGACAAGGG - Intronic
933947592 2:87300128-87300150 CTGAGCCCATGGTGGGAACAAGG - Intergenic
934560670 2:95311715-95311737 CAGAGGTGGTGGTGGCAAAAGGG - Intronic
934607742 2:95710286-95710308 CTGAGGGGATGGGGGAAATCAGG + Intergenic
935179723 2:100678583-100678605 CAGAGGGGATGGTTGGAGAAGGG + Intergenic
935404709 2:102697075-102697097 CTGAGGGGATGCTAGGGAAAGGG - Intronic
936315352 2:111420101-111420123 TTGAGGAAATGGGGGGAAAAGGG - Intergenic
936332604 2:111561449-111561471 CTGAGCCCATGGTGGGAACAAGG + Intergenic
936492894 2:112989141-112989163 GTCAGGGGATGGGGGGTAAAGGG + Intergenic
936752268 2:115659334-115659356 ATGAGAGGTTGGTAGGAAAATGG - Intronic
937762125 2:125617096-125617118 CTGAGGAGGTGTTGGCAAAAGGG + Intergenic
937837256 2:126484186-126484208 CAGTGGGGAGGGTGGGACAAAGG - Intergenic
938145866 2:128834621-128834643 CTCATGGGATGGTGGGCATAAGG - Intergenic
938661064 2:133487743-133487765 CTGAGAGGATGGTGAGAAAGTGG + Intronic
939257965 2:139769443-139769465 AAGAGGTGATGATGGGAAAAGGG - Intergenic
940339652 2:152566873-152566895 CAGAGGGGTGGCTGGGAAAAGGG + Intronic
940498107 2:154459289-154459311 CTTGGGAGTTGGTGGGAAAAGGG + Intergenic
940850455 2:158683232-158683254 ATGAAGGGATGGAGGGAGAATGG - Intergenic
941870039 2:170374371-170374393 GTGAGGGGATGATGAGAAAAGGG + Intronic
943116964 2:183684621-183684643 GTCAGGGGGTGGTGGGAAAGGGG + Intergenic
943894767 2:193342218-193342240 CTGAGGGAATAATGGGAGAACGG - Intergenic
945154915 2:206828397-206828419 CTGCGGTGGTGGTGGGGAAAGGG - Intergenic
945187838 2:207157631-207157653 CTGGGGTGATGGTGGCAAAAAGG + Intronic
945829251 2:214763396-214763418 CTGAGGGGATGATGAGGCAAAGG + Intronic
945920225 2:215748233-215748255 CTGAGGAGGAGGTGGGAAAACGG + Intergenic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946201359 2:218072645-218072667 CTGAGGCCATGGGAGGAAAAGGG - Intronic
946429157 2:219615403-219615425 ATGAGGGCAGGGTGGGAAATGGG + Intronic
946838159 2:223793780-223793802 ATTAGGTGGTGGTGGGAAAAGGG - Intronic
946990005 2:225318044-225318066 CTCAGAAGAAGGTGGGAAAATGG + Intergenic
948021332 2:234736222-234736244 CAGAGGGCATGTTAGGAAAATGG - Intergenic
948586423 2:239022843-239022865 CTGAGGCCAGGGTGGAAAAAAGG + Intergenic
1168984532 20:2036746-2036768 ATGAGTGGATGGTGGGGACATGG + Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169761640 20:9101322-9101344 CTGAGGGGATGGTGAGAGACAGG + Intronic
1169805922 20:9559012-9559034 GTGAGGGCAGTGTGGGAAAATGG - Intronic
1169948218 20:11012145-11012167 GTGAGGGTATGGTGAGAAAATGG - Intergenic
1170871827 20:20212999-20213021 GGGAGGGGAGGGTGGGAACAGGG + Intronic
1170950321 20:20930778-20930800 GGGAGGGGATGGTGGGGATAAGG - Intergenic
1170950329 20:20930798-20930820 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1170950338 20:20930818-20930840 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1170950347 20:20930838-20930860 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1170950356 20:20930858-20930880 GGGAGGGGATGGTGGGGATAGGG - Intergenic
1172074673 20:32285550-32285572 CTGAAAGGATGGTGGGAACTGGG + Intronic
1172965052 20:38828604-38828626 CTGCAGGGATGGTGGCAACAAGG + Intronic
1173028349 20:39330761-39330783 CTGAGGGGCTTGGGGGAAAGAGG - Intergenic
1173604284 20:44319338-44319360 ATGAGGAGATGATGGTAAAAGGG + Intergenic
1173662731 20:44745550-44745572 GGGAGGGGAGGGAGGGAAAAAGG + Intergenic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1174951604 20:55047749-55047771 CTGGGGATATGGTGGTAAAAGGG + Intergenic
1175424874 20:58856912-58856934 CTGGGGGGAGGGTGGGGAACTGG - Intronic
1177073176 21:16537302-16537324 CTGAGTGGATCGTGGGAATGAGG - Intergenic
1177534235 21:22403173-22403195 TTGGCGGGAGGGTGGGAAAAGGG + Intergenic
1178036511 21:28589397-28589419 CTGAGGGGGTTGGGGGAGAAAGG + Intergenic
1180048987 21:45322860-45322882 CTGAGGGGAGGGTGGGTTCAGGG - Intergenic
1180105660 21:45616653-45616675 GGGAGGGGCTGGTGGGAAACCGG - Intergenic
1180751776 22:18129703-18129725 CTGAGGGGCTGGTGTGGGAATGG - Intronic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1184067301 22:42128094-42128116 ATGAGGGGAGGCTGGGCAAAAGG - Intronic
1184070028 22:42141788-42141810 ATGAGGGGAGGCTGGGCAAAAGG - Intergenic
1184908137 22:47505971-47505993 AAGAGGGGAAGGTGGGAAAGGGG - Intergenic
1185109086 22:48890768-48890790 CTGATGGGATGGTGGGTCACTGG + Intergenic
1185285074 22:49996455-49996477 CTCAGTGGCTGGTGGGCAAAGGG + Exonic
949333209 3:2945387-2945409 TTGAGGGGAGGATCGGAAAAAGG - Intronic
949607349 3:5668289-5668311 GAGAGGGGAGGGTGGGAAGAGGG + Intergenic
950017856 3:9766980-9767002 CTGGGGGGAGAGTGGAAAAAGGG - Intronic
950090577 3:10291558-10291580 ATGAGGCGATGGGGGGAAAGTGG + Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950989344 3:17415841-17415863 GTGAGGTGAGGGTGGGAAGAAGG - Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
953469593 3:43155512-43155534 TGGAGGTGATGGTGGGGAAAAGG + Intergenic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
955083054 3:55675558-55675580 CTGTGGAGATGGTTGGAAAGAGG + Intronic
955911105 3:63861394-63861416 TTGAATGGATGGTGGGAGAAGGG - Intronic
956492674 3:69790321-69790343 GGGAGGGGGTAGTGGGAAAAGGG + Intronic
956741443 3:72279290-72279312 GTGAGGGGAGGGAGGGAGAAAGG + Intergenic
956766929 3:72491959-72491981 CTGGGAGGATGGTGGAAAGAAGG + Intergenic
956909005 3:73797439-73797461 ATGTGTGGATGGTGGGAAACAGG - Intergenic
958586123 3:96090571-96090593 GTGAGGATATGGTGGGAAATTGG + Intergenic
959788984 3:110333900-110333922 CAGAGTGGAGGGTGGGAAGAGGG + Intergenic
960063010 3:113342555-113342577 GTGAGATGATGGTGGGGAAAAGG + Intronic
960609838 3:119545499-119545521 CTGAGGGGAGAGGGGGAAAGGGG - Intronic
960737716 3:120798907-120798929 CAGAGGGAATGTGGGGAAAAGGG - Intergenic
961380208 3:126492091-126492113 GTGAGGGGGTGGTGGGAAGGAGG - Intronic
961862696 3:129929820-129929842 ATGAGAGGATAGTGAGAAAAAGG - Intergenic
962199529 3:133390063-133390085 GTAAGTGTATGGTGGGAAAAGGG - Intronic
962356399 3:134698061-134698083 CTGATGGGATGGTGGAGACATGG + Intronic
962922975 3:139967170-139967192 CTGAAGGGATGATGGATAAATGG + Intronic
963962633 3:151326480-151326502 TTGAGGTGATGGTGGGATATTGG + Exonic
964284819 3:155106656-155106678 TTGGGGGGATGGTGGGAGGAGGG + Intronic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
965519099 3:169655197-169655219 TGGCGGGGATGGTGGGAAACTGG - Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967123907 3:186407585-186407607 CTGAGGCAAGGGTGGAAAAATGG - Intergenic
967357019 3:188582979-188583001 TTGGGGCGATGGTGGGGAAATGG - Intronic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
968449236 4:667332-667354 CTGGGGAGAAGGTGGGACAAGGG + Intronic
968969575 4:3786608-3786630 CTGCAGGGATGGTGCAAAAAAGG - Intergenic
969032452 4:4225946-4225968 CAGAGGGGCAGGTGGGAAAGTGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
970012730 4:11477972-11477994 GAGAGTGGATGGTGGGAAAAAGG + Intergenic
970149868 4:13078239-13078261 CTGAAGGGCAGGTGGAAAAAGGG - Intergenic
971059881 4:22955597-22955619 CTGATGGGAGGGTGGGAAAGTGG + Intergenic
971273099 4:25170172-25170194 ATGAGGGGATGATGGCAAAGAGG - Intronic
971497498 4:27282685-27282707 CTTAGGGGATGGTGGAGCAATGG - Intergenic
971658283 4:29378614-29378636 GTCAGGGGGTGGTGGGGAAAGGG + Intergenic
971708051 4:30074152-30074174 GAGAGTGGAGGGTGGGAAAAGGG - Intergenic
974825051 4:67117447-67117469 GTCAGGGGGTGGAGGGAAAAGGG + Intergenic
975827175 4:78331984-78332006 CAGAGGTGATGGGGGGAACATGG + Intronic
976442455 4:85090663-85090685 CTGGGGAGATGCTGGCAAAAGGG + Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978624515 4:110669430-110669452 TTTAGGGGAGGGTGGGAAAGTGG - Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
981085727 4:140681430-140681452 CTGAGTGGATGGCAGGAGAAAGG + Intronic
981736803 4:147961956-147961978 CTGAGGGCACTGTGGGGAAAAGG - Intronic
981801912 4:148667649-148667671 CCGAGGGGATGGTGGGTAGAAGG - Intergenic
982130908 4:152227891-152227913 CTGAGGGGAAGGTGTGAAATTGG - Intergenic
982759718 4:159266857-159266879 CTGAAGACAGGGTGGGAAAACGG - Intronic
983399018 4:167239291-167239313 CTAAGGAGATGATAGGAAAATGG + Intergenic
983513912 4:168637205-168637227 CGGAGGGGTTGGTGGCAGAATGG + Intronic
983627243 4:169814302-169814324 CACAGGGGATGGTAGGAAAGGGG + Intergenic
985730341 5:1543945-1543967 CTGAGGCGAGGGTGGGGAGATGG - Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986909040 5:12532095-12532117 CTGAGCGGCTGCTGGGGAAAGGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987115972 5:14726938-14726960 GTGAGGGGATGATGGGAGAGAGG + Intronic
987773815 5:22338433-22338455 CTGAGAGGGTGGTGGGAAACTGG + Intronic
988996739 5:36722234-36722256 CTGAGAGAATGGTGGGACCAGGG - Intergenic
989125912 5:38052239-38052261 CTGAGGGGTAGGAGGGAGAAAGG + Intergenic
989446110 5:41530713-41530735 CTGAGGGGGTGTTGGTCAAAGGG + Intergenic
989969370 5:50504159-50504181 GAAAGGAGATGGTGGGAAAAAGG - Intergenic
990779445 5:59343095-59343117 GAGAGGGGAGGGTGGGAGAAGGG - Intronic
991410836 5:66343918-66343940 ATGAAGCCATGGTGGGAAAAAGG - Intergenic
991959873 5:72033969-72033991 CTGAGGCGATGGTGGGTTACTGG + Intergenic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
994310258 5:98261024-98261046 TTTAAGGGATTGTGGGAAAAAGG + Intergenic
996416166 5:123212806-123212828 CTGAGGGGATGGGTGAACAAAGG - Intergenic
996540903 5:124629424-124629446 CTGAGGGGATGGTGGGGGCTGGG + Intergenic
997797223 5:136822394-136822416 CTTTGGGGATGCTGGGGAAAGGG - Intergenic
998411599 5:141915370-141915392 CAGAGGGGATGGTGGGACTCAGG + Intergenic
998542650 5:142997413-142997435 TTGAGGGGTTGGTGGGGACAGGG + Intronic
1001042737 5:168348537-168348559 CTGAGGTCAAGGTGGGATAAAGG - Intronic
1001234775 5:170020168-170020190 CTGCGGGGATGGTGGAGAAGAGG - Intronic
1001384660 5:171328896-171328918 AAGAGGGGATGTTGGGCAAAGGG + Intergenic
1001891149 5:175340017-175340039 CTGATGAGGTTGTGGGAAAAAGG + Intergenic
1002297860 5:178241357-178241379 CAGAGGGGATGTGGGGAAGAGGG + Intronic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1003867034 6:10372608-10372630 ATGAGTGCATGGTTGGAAAAGGG + Intergenic
1004308952 6:14526873-14526895 CTCAGTGGGTGGTGGTAAAAGGG - Intergenic
1004560486 6:16744614-16744636 GTGAGGGGCAGGTGGGAGAAGGG + Intronic
1007704644 6:43783361-43783383 CTCAGGGGATGCTGGGAACCAGG + Intronic
1007760599 6:44131360-44131382 CTGAGGGGAGGAGGGGAAGATGG - Intronic
1008778562 6:55072442-55072464 ATAAGGAGATGGTGAGAAAAGGG - Intergenic
1008849318 6:56005616-56005638 CTCAGTGGATGGTAGGAAAAAGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013716984 6:112974159-112974181 CTGAGGAGATGTTGGTCAAAGGG - Intergenic
1014074436 6:117220184-117220206 CTCAGGTGATGGTGGTAGAAGGG + Intergenic
1014078924 6:117266639-117266661 CTGAGGAAATGGAAGGAAAATGG - Intronic
1014950067 6:127543693-127543715 ATGAAGTGAAGGTGGGAAAATGG - Intronic
1016456868 6:144240061-144240083 GTGAAGGGATGGGGGGAAAATGG - Intergenic
1017227254 6:152036550-152036572 CTTAGTTGATGGTGGGTAAAGGG - Intronic
1017630540 6:156392534-156392556 CTGAGTTGTTGGTGGGAAATGGG - Intergenic
1018576313 6:165263621-165263643 CTGAGGGTGTGGTGGAAGAAGGG + Intergenic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1020212070 7:6165069-6165091 CTCTGGGGCTGGTGGGAAAGGGG - Intronic
1020706053 7:11545623-11545645 CTGAGGGGCTCCTGGGAAAGGGG + Intronic
1021170968 7:17397621-17397643 CGCAGGAGATGGTGGGCAAACGG + Intergenic
1021194758 7:17662946-17662968 GTGAGGGAAGGGTGGAAAAAAGG + Intergenic
1021575050 7:22099142-22099164 GGGATGGGATGGTGGTAAAAGGG + Intergenic
1022190487 7:28012927-28012949 CTTAGGTTGTGGTGGGAAAAAGG - Intronic
1022351797 7:29573111-29573133 TTGAGGGGTTGGAGAGAAAAGGG - Intergenic
1023192585 7:37598670-37598692 CTCAGGGCAAGGTGGTAAAATGG - Intergenic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1023601477 7:41885630-41885652 GTGAGGGGAAGGTTGGGAAAGGG + Intergenic
1025844072 7:65179735-65179757 CTGAGGTGAGGTTGGGAAGAAGG + Intergenic
1025894400 7:65686044-65686066 CTGAGGTGAGGTTGGGAAGAAGG + Intergenic
1026247430 7:68633706-68633728 TTCAGGCCATGGTGGGAAAAGGG - Intergenic
1028742126 7:94287240-94287262 ATGCCAGGATGGTGGGAAAATGG - Intergenic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029805916 7:102995997-102996019 TTTAGGGTTTGGTGGGAAAATGG + Intronic
1030187234 7:106776169-106776191 AGGAGGGGGTGGTGGTAAAAGGG - Intergenic
1031346540 7:120673868-120673890 ATGAGGGGAAGGCTGGAAAAAGG - Intronic
1031666400 7:124488955-124488977 ATTAGGGGATGCTGGGAGAAGGG + Intergenic
1031920249 7:127595125-127595147 ATGAGGGGATAGTGGGAAAGTGG + Intronic
1032630160 7:133642423-133642445 CAAAGGGGATGGAGGGAAATAGG - Intronic
1033263538 7:139865233-139865255 CTGAAGGGTTGGTGGGGAAATGG - Intronic
1033584231 7:142762405-142762427 CTGTGGAGATTGTGGGAAAGAGG + Intronic
1034131084 7:148718377-148718399 TTGTGGGGATGGTGGGAATGGGG - Intronic
1034277210 7:149829206-149829228 CTGAGGGGACTGTGGGAAGAGGG - Intergenic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034986389 7:155518104-155518126 CTGAGAGGATGGGAGGAGAAGGG - Intronic
1035112414 7:156494230-156494252 CTGATGGGATGCTGGGAGAGAGG - Intergenic
1035673707 8:1439701-1439723 CCTAGGGGATGGCGGGAAGAAGG - Intergenic
1035907815 8:3532492-3532514 CTGAGGGGAAGGTTGGGATATGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037701375 8:21277358-21277380 CACAGGGGATGAGGGGAAAATGG - Intergenic
1037831852 8:22194449-22194471 CTGCGGGGGTGATGTGAAAAAGG + Exonic
1038007239 8:23442718-23442740 CTGAGTGAATGGAGGGATAAAGG - Intronic
1038929530 8:32177538-32177560 GTCAAGGGATGGGGGGAAAAGGG - Intronic
1039217733 8:35291497-35291519 TGGAGCTGATGGTGGGAAAACGG + Intronic
1039988366 8:42467045-42467067 GGGAGGCCATGGTGGGAAAATGG - Intronic
1041782170 8:61589087-61589109 CAGAGGCTGTGGTGGGAAAAGGG + Intronic
1041992033 8:64005000-64005022 CTGAGGGGTGGGAGAGAAAATGG - Intergenic
1042547190 8:69961303-69961325 CTGAGAGGAGGGTGGGAATGGGG - Intergenic
1043294047 8:78642400-78642422 CTGAGGGGCAGGGGGGAAATAGG - Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1044624528 8:94223787-94223809 GAGGGGGGATGGAGGGAAAATGG + Intergenic
1044950820 8:97433838-97433860 TAGAGGGGAAGGTTGGAAAAGGG + Intergenic
1045064576 8:98434302-98434324 CTGCAGGGATGGTGGCTAAAGGG - Intronic
1046958266 8:120083666-120083688 CTGAAGGGACTGTGGGAAGAAGG - Intronic
1048361624 8:133701989-133702011 CTGAGGTGATGGTGGGGAGGGGG + Intergenic
1048726879 8:137396274-137396296 GTCAGGGGATGGTTGGAAGAAGG - Intergenic
1049272912 8:141705566-141705588 CTGAGCAGATGATAGGAAAATGG + Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049363224 8:142224198-142224220 CGGGGTGGCTGGTGGGAAAAGGG + Intronic
1050398655 9:5227705-5227727 CTGTGGGGGTGGTGGGGCAAGGG + Intergenic
1050504175 9:6330013-6330035 CTGAGGGGCTGGAGGAAAACAGG + Exonic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052384466 9:27807525-27807547 CTGAGGGGATTTTGGGGGAATGG + Intergenic
1052458484 9:28731834-28731856 CTTGGGGGATGCTGGGAAAAGGG + Intergenic
1052472488 9:28917380-28917402 CTGAATGGATGGGTGGAAAATGG - Intergenic
1053588386 9:39484511-39484533 CTAAGGGGTTGTTGGGAGAAGGG - Intergenic
1054577921 9:66880783-66880805 CTAAGGGGTTGTTGGGAGAAGGG + Intronic
1055467612 9:76581113-76581135 CTGAGAGGATGTAGAGAAAAGGG - Intergenic
1056053556 9:82796490-82796512 CTGAGGGTAGGGTGGAAGAAGGG + Intergenic
1056063632 9:82910560-82910582 CAGAGAGGAGTGTGGGAAAAGGG - Intergenic
1056505057 9:87250596-87250618 CAGAGGGGATTCTGGGAAGATGG - Intergenic
1056642309 9:88382124-88382146 GTGATGGGATAGTGGGAGAAAGG + Intergenic
1056904480 9:90633279-90633301 GTGATGGGTCGGTGGGAAAAGGG + Intronic
1057122112 9:92585980-92586002 ATGAGGGGGTGGTGGGACAAAGG - Intronic
1057667403 9:97056581-97056603 CTGAGGTGATGTGGAGAAAAAGG - Intergenic
1057978578 9:99634322-99634344 CTGAGAGCATGGTGGGAATTAGG - Intergenic
1059010340 9:110451110-110451132 CTGAGGGGTTTGGGGTAAAAGGG - Intronic
1059901899 9:118936804-118936826 CAGGGTGGATGGTGGGAAGAGGG - Intergenic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1061254607 9:129447236-129447258 CTGAGGGGATGGTGAATAACTGG - Intergenic
1061954939 9:133956387-133956409 CTGGGGGCCTGGTGGGGAAAGGG + Intronic
1062166576 9:135110760-135110782 CTGAATGGGTGGTGGGAAAGAGG - Intronic
1062475809 9:136726614-136726636 CTGAAGGGATAGTGGGAAGGTGG - Intergenic
1203769682 EBV:43060-43082 CTGAGGTGAGTGTGGGAAGATGG + Intergenic
1186927468 X:14350905-14350927 CGGAGGGGCTGGTGGGAAGGTGG + Intergenic
1187543046 X:20217480-20217502 CTCAGGGGAGGGGAGGAAAAAGG - Intronic
1188008086 X:25031222-25031244 AAGAGGGGATGATGGGGAAACGG - Intergenic
1188110195 X:26188403-26188425 CTGGGGGGATGGGGGAATAAGGG + Intergenic
1189338681 X:40187487-40187509 CAGAGTGGATGGAGGGAAATGGG + Intergenic
1189690757 X:43614488-43614510 CTGAAGAGAAGGTGGGGAAAAGG - Intergenic
1189830481 X:44967958-44967980 GATAGGGGATTGTGGGAAAATGG + Intronic
1190114317 X:47616271-47616293 TGGAGGGGATGCTGGGATAAAGG + Intronic
1190318216 X:49164552-49164574 TTGAGGGGATGGTGCGTAAATGG + Intronic
1191320192 X:59188320-59188342 CTGAGGAGATCGTTGGAAACGGG + Intergenic
1191426817 X:60614782-60614804 CTGAGGAGATCGTTGGAAACGGG + Intergenic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1192411087 X:70932952-70932974 GTGAGGGGATTGGGAGAAAATGG - Intergenic
1192574595 X:72232985-72233007 CTGATGGGTTGGTGGGGAACTGG + Intronic
1192698069 X:73438996-73439018 CTGAGGTGATGGTATGACAAAGG - Intergenic
1193396129 X:80985672-80985694 CTGAGGAGAGGGAGGGAGAAGGG + Intergenic
1193966445 X:87992787-87992809 CTGGGAGGATGTAGGGAAAAGGG - Intergenic
1193991746 X:88316629-88316651 CAGAGAGGATTCTGGGAAAATGG - Intergenic
1195329257 X:103783510-103783532 TTCAGGGGATGGTGGGTAATAGG + Intronic
1195495504 X:105527852-105527874 CAGAGAAGATGGTGGGCAAAGGG - Intronic
1196191631 X:112801070-112801092 TTTCAGGGATGGTGGGAAAAAGG - Intronic
1196911729 X:120490489-120490511 TTGAGGGGTTGGGGGGAAAGGGG + Intergenic
1197487271 X:127068700-127068722 GTCAGGGGTTGGGGGGAAAAAGG - Intergenic
1197720090 X:129739171-129739193 CTGGGTGGATGGAGGGACAAGGG - Exonic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199492233 X:148413066-148413088 CTGAGGGGATTGAGGGGAAATGG + Intergenic
1199674739 X:150178474-150178496 GAGAGGGGAGGGTGGGACAAGGG + Intergenic