ID: 1089020621

View in Genome Browser
Species Human (GRCh38)
Location 11:115210486-115210508
Sequence AATTATTTGGAGACAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089020616_1089020621 24 Left 1089020616 11:115210439-115210461 CCTCTGTCAGATATTTGATATAC 0: 1
1: 0
2: 1
3: 32
4: 358
Right 1089020621 11:115210486-115210508 AATTATTTGGAGACAAGGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 324
1089020615_1089020621 25 Left 1089020615 11:115210438-115210460 CCCTCTGTCAGATATTTGATATA 0: 1
1: 0
2: 3
3: 31
4: 284
Right 1089020621 11:115210486-115210508 AATTATTTGGAGACAAGGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089020621 Original CRISPR AATTATTTGGAGACAAGGGA GGG Intronic
901846464 1:11986048-11986070 ATTCCTCTGGAGACAAGGGAAGG - Intronic
902948464 1:19861307-19861329 ATAAATTGGGAGACAAGGGAGGG - Intergenic
905283124 1:36861724-36861746 AATGATTTGGGGAGTAGGGAAGG + Intronic
906113616 1:43340609-43340631 TATGGTTTGGAGACAAAGGAAGG - Intronic
906403764 1:45524943-45524965 TATTGTTTGGACACAAAGGAGGG - Intergenic
906797307 1:48708406-48708428 AATGATTCTGAGACAAGGCAGGG + Intronic
907171819 1:52474194-52474216 TATTATTTTGAGACAAGGTCTGG - Intronic
907605652 1:55814875-55814897 AATTCTTAGTAAACAAGGGAAGG + Intergenic
909554735 1:76941063-76941085 TAATATTTGGAGACAAGGCTTGG + Intronic
909717418 1:78726059-78726081 AATTATTTTAAGATAAGTGATGG + Intergenic
910749331 1:90611535-90611557 AAATATTTGGGAAGAAGGGAGGG + Intergenic
910806405 1:91193155-91193177 AATTTTTTGTAGAGATGGGAGGG - Intergenic
913188936 1:116396967-116396989 TATTATTTGCAGAGCAGGGAAGG + Intronic
913482369 1:119301016-119301038 AAGTGTTTGGAGACAGGGGTTGG + Intergenic
915436663 1:155911580-155911602 AATTATTTACACAAAAGGGAAGG + Intergenic
917926270 1:179791449-179791471 AGTTCTTTGGGGACAGGGGATGG + Intronic
918432513 1:184476790-184476812 ACTGTTTTGGAGACAAAGGAAGG - Intronic
919548245 1:198950142-198950164 AATGATATGGGGACATGGGAGGG + Intergenic
920519827 1:206614981-206615003 AAGTATTTGGAAGCAAGGGTAGG + Intergenic
920666651 1:207967652-207967674 AGTTATGTGGCCACAAGGGAAGG + Intergenic
920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG + Intergenic
921362705 1:214344614-214344636 AATTATGTGGAGACAACAAAGGG - Intergenic
921805026 1:219444431-219444453 GATGATTGTGAGACAAGGGAGGG - Intergenic
922368186 1:224885601-224885623 AATTTTTTGCAGGCAGGGGATGG - Intergenic
922369304 1:224893362-224893384 AATTTTTTGCAGGCAGGGGATGG - Intergenic
922378147 1:224990923-224990945 AAGGATGTGGAGAAAAGGGAAGG - Intronic
924146193 1:241077408-241077430 CAGTACTTGGAGAGAAGGGATGG + Intronic
924575734 1:245279191-245279213 AATTAGCTGAAGTCAAGGGAAGG + Intronic
1064342358 10:14498909-14498931 AATTTTTTGTAGAGATGGGAAGG + Intergenic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1065519649 10:26559271-26559293 AAGTGTTTACAGACAAGGGATGG + Intronic
1066399628 10:35063280-35063302 AATTATTTGAAGACACTGTAAGG + Intronic
1067976892 10:51036628-51036650 AATTATTGGAAGGAAAGGGAAGG + Intronic
1069332526 10:67310106-67310128 AAGTAGGTGGAGATAAGGGAAGG + Intronic
1071935406 10:90525569-90525591 ATTTGTTTGGAGACAAGTAATGG - Intergenic
1072213644 10:93269932-93269954 AACTTTTTGGAGAAAAGTGATGG + Intergenic
1073004655 10:100314111-100314133 AATTATTTGCAGGCAAGTCATGG - Intronic
1074874265 10:117602173-117602195 AAGTAGATGGAGAAAAGGGAAGG + Intergenic
1075503752 10:123002974-123002996 GATTATTTGGAAAAAATGGATGG + Intronic
1075844227 10:125532292-125532314 AATTTTTTTGAGACAAGGTCTGG + Intergenic
1075910660 10:126123074-126123096 AATTGTTTGCAGTAAAGGGAAGG - Intronic
1078356594 11:10636676-10636698 AAATATAAGGAAACAAGGGATGG + Intronic
1078380986 11:10840649-10840671 TATTTTTTGGAGACAAGGTCTGG + Intronic
1078717087 11:13850611-13850633 AATTATTTGGAGGTTAGGAAGGG - Intergenic
1078903477 11:15663027-15663049 ACTAAATTGGGGACAAGGGAAGG - Intergenic
1079939114 11:26655914-26655936 AATTATTGGGAGAAAACGGCAGG + Intronic
1080420278 11:32103802-32103824 AAGTATTTGGTGACAATGAATGG - Intronic
1081228914 11:40560613-40560635 GATTATTTTGAGAAAAGGAAAGG + Intronic
1082717129 11:56627862-56627884 AAGAATTTGGAGACACGGGTGGG + Intergenic
1083085649 11:60141929-60141951 AAATATTTTGAGACAAGGAAAGG + Intergenic
1083282462 11:61635679-61635701 AATAATCTGGAGACCAGGGGAGG - Intergenic
1083606356 11:63981194-63981216 AATTGGTTGGGGACAAGGGTAGG - Intronic
1084300114 11:68243985-68244007 AATTATTTGGAGATGGGGGTGGG - Intergenic
1085235039 11:75008169-75008191 AATGATTTAGAGCCAAGGAATGG - Exonic
1086253305 11:84843785-84843807 AAATATTTGGGGAAAAAGGATGG - Intronic
1087949996 11:104209146-104209168 ACATATTTTGAGAGAAGGGAGGG - Intergenic
1088461439 11:110087565-110087587 CATTGTTTGGTGAAAAGGGAAGG - Intergenic
1089020621 11:115210486-115210508 AATTATTTGGAGACAAGGGAGGG + Intronic
1089830059 11:121319571-121319593 AATTTTCTAAAGACAAGGGAGGG - Intergenic
1090231909 11:125113338-125113360 AATAATATGGAGACAAATGATGG + Intergenic
1090699449 11:129280263-129280285 GAGGTTTTGGAGACAAGGGAAGG + Intergenic
1092898670 12:13038050-13038072 ATTTATTTTGAGACAAGGTCTGG - Intergenic
1093061875 12:14615952-14615974 AAGCATTTGGAGACAACTGATGG + Intronic
1094080886 12:26534003-26534025 AATTACTTGGAGAAAAGGCTGGG - Intronic
1094126875 12:27032736-27032758 AATTATTTTGAGGCAAAGAATGG - Intronic
1094476108 12:30841958-30841980 AGTTATTTGGAGCCATGGGTTGG - Intergenic
1094558021 12:31522454-31522476 TATTATTTTGAGACAAGGTCTGG + Intronic
1095749364 12:45694406-45694428 AATTAGTTGAACCCAAGGGAGGG - Intergenic
1095764932 12:45884668-45884690 AATTATTAGGAGGAAAGGAAAGG + Intronic
1096253396 12:50048073-50048095 AATTATTTGGAGAAAAGATTAGG + Intergenic
1096740993 12:53694194-53694216 AATTCTATAGAGACCAGGGAGGG + Intergenic
1097379949 12:58882799-58882821 CATTATTTGGATAAATGGGAGGG + Intronic
1099009364 12:77273488-77273510 AATAATTCAGAGAAAAGGGAAGG + Intergenic
1099098184 12:78402092-78402114 ATTTATTTGGGAACAAGAGATGG + Intergenic
1099343321 12:81466736-81466758 ACGTATTTGGAGGCAAGGTAGGG + Intronic
1099837502 12:87925457-87925479 AAGTAGTGAGAGACAAGGGATGG - Intergenic
1099852814 12:88124033-88124055 AATAATCTGGAGAAAAGTGATGG - Intronic
1100912702 12:99383551-99383573 AATTATGTGGTCACAAAGGAGGG - Intronic
1101561067 12:105858801-105858823 AAGGATTTGGTGACAAGAGATGG + Intergenic
1101980985 12:109406707-109406729 ATTTTTTTAGAGACAAGGTATGG - Intronic
1102264696 12:111473260-111473282 AATTTTTTGGAGACAAGGTCTGG - Intronic
1103846382 12:123904467-123904489 ATTTATTTGAAGAGAAGGAACGG + Intronic
1106884653 13:34171482-34171504 AAATATTGGGAGATAATGGAAGG - Intergenic
1107121821 13:36804457-36804479 ATTTATTTGGAGACAGGGTCTGG + Intergenic
1107283681 13:38765477-38765499 AATCATTTGGAGACAAGCATAGG - Intronic
1107698812 13:43026404-43026426 AATAATTTGAATAGAAGGGAGGG - Intronic
1107932931 13:45321282-45321304 AGTTATTTATATACAAGGGAAGG + Intergenic
1109179998 13:59202319-59202341 AAGCATTTGGATACAAGGGAGGG + Intergenic
1109462748 13:62684548-62684570 AATTATTTGCACACATGGGCAGG - Intergenic
1111682032 13:91455042-91455064 AATTAAATGGATAAAAGGGATGG - Intronic
1112296608 13:98193005-98193027 AATTATTGGAAGACAAGGGCTGG - Intronic
1112464463 13:99631308-99631330 AAATATTTGGAGACAGGGTCTGG - Intronic
1114264332 14:21063436-21063458 GGTTATTTGGAGGCAAGGCAAGG + Intronic
1114441969 14:22755967-22755989 AAATATTTGGAGGCCAGGCATGG + Intergenic
1116487551 14:45468828-45468850 AATTATTTGGAGAGAGGTGAGGG + Intergenic
1116547646 14:46189824-46189846 AACTATTGGGATACTAGGGAAGG + Intergenic
1117056799 14:51920470-51920492 AAATATTTGGAAAAAATGGATGG - Intronic
1117551478 14:56841145-56841167 ATATCTTTGGTGACAAGGGATGG + Intergenic
1117566319 14:56997153-56997175 AATCAGGTGGAGACACGGGAGGG - Intergenic
1117644364 14:57835838-57835860 AATCATTTGGAGACTAGACATGG - Intronic
1118965971 14:70585788-70585810 AATTTTTTAGAAAAAAGGGAGGG + Intronic
1119361099 14:74050816-74050838 AATTATTTGTAGGCCAGGCATGG + Intronic
1121882405 14:97512733-97512755 ACTTATTTGGAGAAAAGCAAAGG + Intergenic
1124389263 15:29239224-29239246 AAGCATTTGGTGGCAAGGGAAGG - Intronic
1124480249 15:30073248-30073270 GATTATTTGGAGATAAAGGAGGG - Intergenic
1125199674 15:37091884-37091906 CATTATTGGGAGACTGGGGAGGG - Intronic
1126835321 15:52658050-52658072 ATCTATTTGGAGACAGTGGAGGG - Intronic
1127152243 15:56087987-56088009 ATTTCTATGGAGAGAAGGGAGGG + Exonic
1127827107 15:62713832-62713854 AGGGATTAGGAGACAAGGGAAGG - Intronic
1127858141 15:62969291-62969313 AATGATTTTTAGAAAAGGGAGGG - Intergenic
1128163454 15:65440233-65440255 ATTTATTTTGAGACAAGGTCTGG + Intergenic
1128928393 15:71680183-71680205 ACTGCTTTAGAGACAAGGGAAGG - Intronic
1130562873 15:84972224-84972246 AATTGGTTGGAGGAAAGGGATGG + Intergenic
1131648715 15:94375434-94375456 AATTATCAGGAGGCAATGGAGGG + Intronic
1131920537 15:97323368-97323390 ACTTATTTACAGATAAGGGATGG + Intergenic
1132367892 15:101270860-101270882 AATGATTAGGAGATAATGGAGGG - Exonic
1135076324 16:19396913-19396935 AATTACTTGGAGACAGGCAAAGG - Intergenic
1135089311 16:19500287-19500309 ACTGAAGTGGAGACAAGGGATGG - Intergenic
1136869505 16:33792802-33792824 AATTATGTAGAGACATGGCAAGG + Intergenic
1137633320 16:49963787-49963809 AATTATTTGTAGAGATGGGGGGG - Intergenic
1137934412 16:52620698-52620720 AAATATTTACAGACAAGGGTGGG - Intergenic
1137985492 16:53103968-53103990 AATGCTTTGGCGAGAAGGGAAGG - Intronic
1140325552 16:73998381-73998403 AAAAGTTGGGAGACAAGGGAGGG - Intergenic
1141690550 16:85594075-85594097 ACTTCTTTGCAGAAAAGGGAGGG + Intergenic
1203102668 16_KI270728v1_random:1323266-1323288 AATTATGTAGAGACATGGCAAGG - Intergenic
1142648566 17:1330980-1331002 AAATACTTGGAGACATGGCAGGG - Intergenic
1143473347 17:7190048-7190070 ATTTTTTTGGGGAAAAGGGAGGG - Exonic
1144815186 17:18029152-18029174 AATTAATTGGAGAGAGGGGATGG - Intronic
1148577478 17:48722190-48722212 AAGTTTTGGGAAACAAGGGAAGG - Intronic
1149559444 17:57597844-57597866 AATTAATTGATGGCAAGGGAGGG - Intronic
1149761699 17:59237387-59237409 ATTTATTTTGAGACAAGGTCTGG - Intronic
1150205174 17:63399147-63399169 AAATATTTGGAAACAAGAGAGGG - Intronic
1151448246 17:74181335-74181357 AATGAGGTGGAGACAAGGGGAGG - Intergenic
1155098415 18:22583163-22583185 ATTTATATGGAAACAAGCGAAGG + Intergenic
1155413275 18:25569575-25569597 TATTTTTTGGAGACAGGGTATGG + Intergenic
1155705186 18:28801801-28801823 AATTATTTGAGGACAAGATAAGG - Intergenic
1155810815 18:30232207-30232229 AATTATTTGAAAATAAGGTAGGG + Intergenic
1156605829 18:38665987-38666009 TATTATTTGGGGACTAGGCAGGG + Intergenic
1156845362 18:41659465-41659487 AAATATTTGGGGAAATGGGAAGG + Intergenic
1158199492 18:54924105-54924127 AATTATGTTGAGACATTGGAAGG - Intronic
1159097601 18:63921934-63921956 AGTTATTTGGGGGCAAAGGAGGG - Intronic
1159145342 18:64447001-64447023 AAGTATTTGAAGAAAAAGGAAGG + Intergenic
1162243630 19:9380010-9380032 AATTATTGGGAGAAAAGGTTGGG - Intronic
1164832757 19:31335282-31335304 AATTATTTGGAAAGGAGAGATGG + Intronic
1166328257 19:42064427-42064449 AAGTATTTGGAGCCAAGAAATGG - Intronic
1166639790 19:44486380-44486402 AAATATTTGGAAACCAGGAAAGG + Intronic
1168126928 19:54289389-54289411 AAATACATGGAGACAAGGGAAGG + Intergenic
1168173525 19:54607071-54607093 AAATACAGGGAGACAAGGGAAGG - Intronic
925475264 2:4206271-4206293 AATTATATGCAAATAAGGGATGG + Intergenic
925658724 2:6179946-6179968 ATTTACTTGGGGAAAAGGGAGGG + Intergenic
926476062 2:13323969-13323991 AATTAGTTGGAGGCAAGGCTAGG + Intergenic
926664661 2:15508064-15508086 AATTATTGTGAGGTAAGGGAAGG + Intronic
927501743 2:23587890-23587912 AATAATTTAGAGGCTAGGGAAGG + Intronic
927583026 2:24272291-24272313 AAATATCTGGAGAGAAAGGAAGG - Intronic
931161352 2:59694522-59694544 AATTATTAAGATTCAAGGGAGGG + Intergenic
931990281 2:67783261-67783283 AATTTCTTGGAGAAAGGGGAAGG - Intergenic
932201701 2:69833862-69833884 AATTTTTTAGAGACAAGCTACGG - Intronic
932503828 2:72209500-72209522 AAATTTTTGGAGACAAGGTCTGG - Intronic
932605037 2:73159595-73159617 AATTTTTTTGAGACAAGGTCTGG - Intergenic
933736024 2:85495060-85495082 ATTTATTTTGAGACAAGGTCTGG + Intergenic
935207756 2:100911250-100911272 AATTACTTGAAGAAAGGGGAAGG - Intronic
936235453 2:110738794-110738816 AAATATTAGAAGACAAGGCAAGG - Intronic
939236672 2:139503223-139503245 AATTAAATGGAGACATAGGATGG - Intergenic
939833506 2:147100715-147100737 AATTCTTTAGTGACAAGTGATGG - Intergenic
941003802 2:160226898-160226920 AAATACTTGGAGACTATGGATGG + Intronic
941148640 2:161886085-161886107 ATTTATTTTGAGACAAGGTCTGG - Intronic
941955544 2:171200556-171200578 AATTATTTGGAACCTGGGGATGG + Intronic
942685738 2:178530069-178530091 AACTCTCTGAAGACAAGGGAGGG - Exonic
942988554 2:182171804-182171826 AAGTCTTTGGATACAAGGTATGG - Intronic
944513464 2:200487316-200487338 AATAATTTGGAGACAGGAGGTGG + Intergenic
945144937 2:206728264-206728286 AAATATTTGGAGAAAAAGGCAGG - Intergenic
945408870 2:209485735-209485757 AAATATTTGGAGACTAGTGTGGG - Intronic
945679889 2:212901428-212901450 AACTATTTGAAGACCAAGGAGGG + Intergenic
948202330 2:236138193-236138215 AATTTTTTGTAGAGAAGGGGGGG + Intergenic
948262891 2:236617311-236617333 CATTTATTGGAGACAAAGGACGG - Intergenic
948693532 2:239721386-239721408 CTTTATGTGGAGACAAGGAAAGG + Intergenic
1169433079 20:5556948-5556970 AATGATATGGAGACAAGTCAGGG + Intronic
1169769091 20:9181959-9181981 AATGATTTTGAGAAAAGGAAGGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1169882258 20:10359596-10359618 AATTATTTGCATTCAACGGAAGG + Intergenic
1169995299 20:11549407-11549429 AATTATTTTGAGACAAAAGTTGG - Intergenic
1173151417 20:40569403-40569425 AATGCTTTGGGAACAAGGGAGGG + Intergenic
1173515034 20:43659045-43659067 AATTTTTTAGAGACAAGGTCTGG - Intergenic
1173636182 20:44560236-44560258 ATTTATTTAGAGACAAGGTCTGG - Intronic
1173707880 20:45125757-45125779 GATCATTTGGATACCAGGGATGG + Intergenic
1174975882 20:55333220-55333242 AATTATTAGGAGAATATGGAAGG - Intergenic
1177962136 21:27680295-27680317 AATTCTTGGCAGACAGGGGAGGG - Intergenic
1178002008 21:28172253-28172275 AATTTCATGGAGAAAAGGGAGGG - Intergenic
1178036197 21:28585760-28585782 AATTATAGGGAGAATAGGGAAGG + Intergenic
1178159579 21:29896043-29896065 AAATATTTGGAAAAAAGCGAGGG - Intronic
1180507555 22:16028959-16028981 AATTATTTTGAAAAATGGGAGGG + Intergenic
1182860889 22:33558306-33558328 CTTCATTTGGAGATAAGGGAAGG + Intronic
1183139159 22:35919787-35919809 AGGCATTTGGAAACAAGGGATGG - Intronic
1183567039 22:38622978-38623000 AATTGTTGGGAGGCAGGGGATGG - Intronic
1183908186 22:41058878-41058900 ATTTATTTCGAGACAGGGGCTGG + Intergenic
1184204865 22:42995618-42995640 AATTATTTGGAAATAAGGATGGG + Intronic
1184328616 22:43811463-43811485 AAAGATTTGGAGAGAAAGGAAGG + Intronic
952271389 3:31835433-31835455 AATTAAAAGGAGGCAAGGGAGGG + Intronic
952678078 3:36057325-36057347 AATTGTTTGAAGACACTGGAGGG + Intergenic
953055043 3:39381320-39381342 ATTTATCTGCAGTCAAGGGAAGG - Intergenic
953620744 3:44530547-44530569 AATTAAATGGGGGCAAGGGATGG + Intergenic
954929484 3:54268810-54268832 AATCATTAGAAGACAAGGGGAGG - Intronic
955412434 3:58664596-58664618 CATTCTTTTGAGATAAGGGAGGG + Intronic
955525383 3:59814608-59814630 ACCTATGTGGGGACAAGGGATGG - Intronic
955629282 3:60954873-60954895 AAGTATTTTGAGCCAAGTGAGGG - Intronic
956305265 3:67817081-67817103 AAGTATTTGGAGAAAAGGGAGGG + Intergenic
957090403 3:75724184-75724206 TATTTTTTGGATACAAGGCAAGG - Intronic
959806501 3:110561432-110561454 ATTTATTTGGAGAAAAGAAAGGG - Intergenic
959816892 3:110684147-110684169 AATTTTTTGCAGGCAGGGGATGG - Intergenic
960649454 3:119930236-119930258 AAAAATATTGAGACAAGGGAAGG - Intronic
960998893 3:123359062-123359084 AATGAGTTGGAGACTAGGGTTGG + Intronic
963679590 3:148357442-148357464 AAGTCTTTGGAGAGAAGGGAGGG - Intergenic
964599336 3:158478649-158478671 AAATAATTGGAGTGAAGGGAGGG - Intronic
965475953 3:169155379-169155401 TATTTATTGGGGACAAGGGAAGG - Intronic
965895099 3:173566016-173566038 AATTATTTGTAGAGAAAGAAGGG + Intronic
968877897 4:3283825-3283847 AAGTCTTTGAAAACAAGGGAAGG - Intergenic
970197713 4:13568663-13568685 AATTATTTAGAGAGAAGAAATGG + Intergenic
970322570 4:14889459-14889481 TCTGATTTGGAGACCAGGGAAGG - Intergenic
971519998 4:27537629-27537651 AATTATTTGTATACATGGGAAGG + Intergenic
972979899 4:44684485-44684507 AATTATTCTAAGACAATGGAAGG + Intronic
973577993 4:52312159-52312181 AAATATTTGGAGATTAGGGAAGG - Intergenic
974210185 4:58763124-58763146 AATTATTTGGGGAGGAGGTATGG + Intergenic
975384600 4:73741438-73741460 GATTATTTGGAGACTATGGAAGG - Intronic
975695716 4:77011003-77011025 AATGATTTGGTGAGAAGAGAGGG + Intronic
977492523 4:97732641-97732663 AAATATTTGGAAACTATGGATGG + Intronic
978336069 4:107670707-107670729 AAATTTTTGGAGACAAGGACAGG + Intronic
978939620 4:114420764-114420786 ATTTAGTGGGAGACAAGGTAAGG - Intergenic
980116417 4:128683785-128683807 AATTATGTGGGGGCAGGGGATGG - Intergenic
980264407 4:130496257-130496279 ATTGATTAGGAGAGAAGGGAGGG + Intergenic
980404303 4:132336682-132336704 AATTATTGGGAGACTGGGCATGG - Intergenic
980490523 4:133520548-133520570 AATTATTTGAAGAGAAAGAAAGG + Intergenic
982802377 4:159721342-159721364 ATTTATTTTGAGACAAGGTCTGG + Intergenic
983326359 4:166262572-166262594 AATTTTTTTGAGCCAAGTGAAGG + Intergenic
983660772 4:170128643-170128665 AATTACTTGGAGACAGGCAAAGG - Intergenic
984718845 4:182951871-182951893 ATTTATATGGATACAAGAGAGGG + Intergenic
985061100 4:186080427-186080449 AATTATTTGGAGAAAAGCCAGGG - Intronic
986128514 5:4905726-4905748 AATTATTTGGAGCCAAACAAAGG + Intergenic
986992655 5:13571947-13571969 AATAATTAGGAGACCAGAGAAGG + Intergenic
987866233 5:23542681-23542703 AATCATTTTGAAATAAGGGAAGG - Intergenic
987997643 5:25306967-25306989 GAATATTTGGAGACAAGGTGGGG - Intergenic
990009105 5:50974528-50974550 AATTCATTGAAGACATGGGAAGG - Intergenic
991232220 5:64347405-64347427 AACTATCTGGAGAAGAGGGAAGG + Intronic
992301369 5:75385015-75385037 AATAAATTGGGGAAAAGGGAAGG - Intronic
993155383 5:84215631-84215653 AACTTTTTAGAGACAAAGGAAGG + Intronic
994032412 5:95158907-95158929 TATTATTTTGAGACAAGGTCTGG - Intronic
994498453 5:100543161-100543183 ATTTATTTAGAGACAAGGTCTGG + Intronic
996580838 5:125030372-125030394 AATTTTTTGCAGGCAGGGGATGG + Intergenic
997156968 5:131571974-131571996 AATTTTTTGCAGGCAGGGGATGG - Intronic
998527358 5:142854973-142854995 TATGATGTGGAGGCAAGGGAAGG - Intronic
999150595 5:149423791-149423813 ATTTATGTTGAGATAAGGGATGG - Intergenic
999687145 5:154113126-154113148 AATTATTAGTAGACCATGGATGG - Intronic
1000841238 5:166220988-166221010 AATTGTTTGCAGATAAAGGAAGG - Intergenic
1003087939 6:3076501-3076523 AATTATTTGTAGAGATGGGGGGG - Intronic
1003191830 6:3881161-3881183 AAATCTTTGGGGACAAGGGAGGG + Intergenic
1003891342 6:10566307-10566329 AATTTTTAGGAGACAAGGCCTGG + Intronic
1004050970 6:12078764-12078786 AATTATTTGCTGACAAGGGGTGG + Intronic
1004791399 6:19030714-19030736 AATTATATGGAAAGAAGAGAAGG + Intergenic
1005401766 6:25441485-25441507 ATATATTTGGAGACAGGAGATGG - Intronic
1006722079 6:36161998-36162020 AATTCTTTTGAGACAAGGTCTGG - Intergenic
1007018614 6:38495956-38495978 AATCCTTTGGAGAGAAGAGATGG + Intronic
1007206467 6:40156209-40156231 ATTTTTTTGGAGGCAGGGGAGGG + Intergenic
1008423228 6:51327283-51327305 AATTTTTTGGGGACCATGGAAGG + Intergenic
1008520801 6:52361360-52361382 CATTATCTGGAGAAAAGAGAAGG - Intergenic
1008730947 6:54481581-54481603 AATAATATGGAAGCAAGGGAAGG - Intergenic
1008792391 6:55252566-55252588 ACTTATTTGCAGAGAAGGAATGG + Intronic
1008886742 6:56439540-56439562 ATTGATTTGGGGACAAGAGAGGG + Intergenic
1009715605 6:67390316-67390338 AATTATTTTGAAAAATGGGAGGG - Intergenic
1011987132 6:93462373-93462395 AAATATTTGGAAAAAATGGAGGG + Intergenic
1012954400 6:105553299-105553321 AAGTACTAGGAGATAAGGGAAGG + Intergenic
1013356769 6:109352094-109352116 AATTATTTGGAGACAATGTGAGG - Intergenic
1014195611 6:118554987-118555009 AATTATTTTGAGACAAAACATGG - Intronic
1014333336 6:120099042-120099064 AATTATTTTGAGACCAGGCATGG + Intergenic
1016394293 6:143605734-143605756 AAGTATTTATAGGCAAGGGAGGG + Intronic
1021758365 7:23878068-23878090 AAGTATATGGAGAAAAGTGAGGG + Intergenic
1022743797 7:33149105-33149127 GATGATTTGGAGACCATGGAGGG + Intronic
1022925579 7:35053050-35053072 AATTATTGGGAGATAATTGAAGG - Intergenic
1023954839 7:44876248-44876270 AATTATGTGGTGATAGGGGAGGG - Intergenic
1026075782 7:67166536-67166558 AATTATTTTTAGAGAGGGGAGGG - Intronic
1026575495 7:71568012-71568034 AATTCTTTGGAGCCAAAGGGTGG - Intronic
1026701073 7:72645752-72645774 AATTATTTTTAGAGAGGGGAGGG + Intronic
1028396237 7:90371446-90371468 AATTTTTTGCAGACAATAGAGGG + Intronic
1028633622 7:92962705-92962727 AAGTATTGGGAAACCAGGGAAGG + Intergenic
1029823584 7:103167747-103167769 AATTATTGGGAGATAATTGAAGG - Intergenic
1030503416 7:110388004-110388026 AATGATTTGGAGACTAGGGAAGG + Intergenic
1030654986 7:112157542-112157564 AATTATTTGGAGATAATGTAAGG + Intronic
1031410556 7:121436260-121436282 AATTATTTGGATTAAAGGAAAGG - Intergenic
1031519600 7:122747386-122747408 AATTATTTGTAGAAAAGCGTTGG - Intronic
1031571197 7:123362198-123362220 ACTGATTAGAAGACAAGGGAAGG + Intergenic
1032287075 7:130547034-130547056 ACTTATTTGGAGACTTGGGAAGG - Intronic
1033986592 7:147234170-147234192 AAGTATTTGGAGATGATGGATGG - Intronic
1034732917 7:153403517-153403539 AAATATTTGGAGAGAAGGAGAGG - Intergenic
1036980710 8:13467187-13467209 AATTATTTGGAAATAAGAAAAGG - Intronic
1037412471 8:18613250-18613272 AATCATTTGGGGAAAAGGGTGGG - Intronic
1039060554 8:33568913-33568935 ATTTATTTAGAGACAAGGTCTGG + Intergenic
1039298942 8:36188558-36188580 AATTATTTGGGGAAAGGGGCAGG + Intergenic
1039551820 8:38449150-38449172 ATTAATTTGGAGATAGGGGAAGG + Intronic
1039640286 8:39212489-39212511 AATTATCTGGAGACAGGTGGAGG - Intronic
1040906131 8:52471562-52471584 AATTTTTTGTAGAGATGGGAAGG + Intergenic
1041547572 8:59062762-59062784 AATTATTTGGAAAAGAGAGAGGG + Intronic
1043283266 8:78496397-78496419 CAGTATTTGGAGAGGAGGGAAGG + Intergenic
1043824883 8:84914844-84914866 AATTAGTAGGAGATAAGGGATGG - Intronic
1043861654 8:85324258-85324280 AATTTTTAGGGAACAAGGGAAGG - Intergenic
1043965141 8:86465606-86465628 ATTTATTTGGAGACAGGGTCTGG - Intronic
1044471960 8:92580968-92580990 AATTACTTGAAGACATCGGAAGG - Intergenic
1044772673 8:95653682-95653704 AATTTTTTGGTGACAAAGGCAGG - Intergenic
1044903247 8:96971557-96971579 AATTATTTGGGAACAAAGGAAGG + Intronic
1045010422 8:97953948-97953970 AATTTTTTTGAGACAAGGTCTGG - Intronic
1045703994 8:104899004-104899026 AATCATTTGGAGACATGCCATGG - Intronic
1047059504 8:121208681-121208703 TATGAGTTGGAGAGAAGGGAAGG + Intergenic
1047935647 8:129775791-129775813 CATTTAGTGGAGACAAGGGATGG - Intronic
1048277056 8:133074636-133074658 AATTCTGTGGAGAGAAGGGCTGG - Intronic
1048550019 8:135425479-135425501 CATTATTTGGAGGCAACGAAAGG + Intergenic
1050631698 9:7565892-7565914 AAGCACTTGGAGACAAGGAAAGG - Intergenic
1050832574 9:10031834-10031856 TATTTTTTGAAGACAAGAGATGG + Intronic
1050839390 9:10128157-10128179 AATTATTTTGAGTCAAGCAAAGG - Intronic
1050936668 9:11405394-11405416 AATTATTTTGAGAAATGTGAAGG + Intergenic
1051159126 9:14185842-14185864 AAATATTTGGAAACAAGATAGGG + Intronic
1051954191 9:22670043-22670065 AATTATATGGAGAAAAGGTAGGG - Intergenic
1052533428 9:29717728-29717750 AAGGATGTGGAGAAAAGGGAGGG - Intergenic
1053149958 9:35737038-35737060 AATTGGGTGGAGAGAAGGGAAGG + Exonic
1055733564 9:79304417-79304439 AATTATTTGAACCCAAGGGATGG - Intergenic
1056141096 9:83680653-83680675 AATTATTAGGGCACAAGGTATGG - Intronic
1057334406 9:94144467-94144489 AACTGTTTGGAGCCAAGGCAGGG - Intergenic
1058383104 9:104400815-104400837 AATTCTTTGGACAGAAGAGATGG - Intergenic
1058615819 9:106826783-106826805 AATTATTTGTAGAGATGGGGGGG + Intergenic
1059002725 9:110366983-110367005 AATTATCTGGAGAAAAGGCCAGG + Intronic
1059251085 9:112888800-112888822 AATCATTTGGAGTCAAGCAAGGG - Intronic
1060428212 9:123524505-123524527 AAATATTTGGAGACAGGGCATGG - Intronic
1061141237 9:128768424-128768446 AGTTAGTCGGAGGCAAGGGAAGG + Intronic
1061689614 9:132315559-132315581 GGTCATTTGGAGACAAGGAAGGG - Intronic
1061944409 9:133900726-133900748 GATTAATTGGAGAAAAGGCAAGG - Intronic
1185529527 X:806540-806562 AATGCTTTGGGGACAGGGGATGG - Intergenic
1185801141 X:3012245-3012267 AATTATATGGAGGCCAGGCACGG + Intronic
1186683201 X:11897424-11897446 AATTAGCTGGAGAAAAGGGTGGG + Intergenic
1188580893 X:31712106-31712128 AATTATTTTTAAATAAGGGAAGG + Intronic
1189031126 X:37452010-37452032 AATTATCTGGCATCAAGGGAGGG - Intronic
1189362872 X:40366752-40366774 AATAATTAGGAGACAACAGAAGG + Intergenic
1190404875 X:50077086-50077108 AATTGTTTGTAGACCAAGGAGGG - Intronic
1192379894 X:70604649-70604671 TATTACTTGGAGAGGAGGGAAGG + Intronic
1192764919 X:74130365-74130387 AATTTTTTGCAGGCAGGGGATGG + Intergenic
1193386409 X:80877127-80877149 CAGAATTTGGAGACAAAGGAGGG - Intergenic
1193698037 X:84733134-84733156 AAATATTTTGAGACAAAAGAAGG - Intergenic
1193776677 X:85650796-85650818 AATTATTTTGAGACTTAGGAGGG - Intergenic
1196983468 X:121241566-121241588 AATGATAAGGAGACAAGGAAAGG - Intergenic
1197380724 X:125736025-125736047 AATTGTTTGGAGAAAAGTAAGGG - Intergenic
1197876655 X:131115550-131115572 AACTGTTGGGAGATAAGGGAGGG + Intergenic
1198721286 X:139623788-139623810 AAATAAATGGAGAGAAGGGAAGG + Intronic
1199828058 X:151519370-151519392 AAATATTAGGAGTCAAGTGAAGG + Intergenic
1200170012 X:154065608-154065630 AATTTTTTGTAGACATGGGCTGG - Intronic
1200315171 X:155124801-155124823 AATTATTTGAAAACATGGAAAGG + Intronic
1200656418 Y:5908376-5908398 AATTAGTTTGAGACTAGGCACGG + Intergenic
1201245953 Y:12003925-12003947 AATTAAATGGTGACAATGGATGG - Intergenic