ID: 1089022459

View in Genome Browser
Species Human (GRCh38)
Location 11:115230495-115230517
Sequence CAGGGTAACTTTGAAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 305}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089022451_1089022459 8 Left 1089022451 11:115230464-115230486 CCCCTAAGACCTTTGTGCAGGGT 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1089022459 11:115230495-115230517 CAGGGTAACTTTGAAAAGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 305
1089022454_1089022459 -1 Left 1089022454 11:115230473-115230495 CCTTTGTGCAGGGTACTACCTGC 0: 1
1: 0
2: 6
3: 33
4: 185
Right 1089022459 11:115230495-115230517 CAGGGTAACTTTGAAAAGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 305
1089022452_1089022459 7 Left 1089022452 11:115230465-115230487 CCCTAAGACCTTTGTGCAGGGTA 0: 1
1: 0
2: 0
3: 2
4: 96
Right 1089022459 11:115230495-115230517 CAGGGTAACTTTGAAAAGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 305
1089022453_1089022459 6 Left 1089022453 11:115230466-115230488 CCTAAGACCTTTGTGCAGGGTAC 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1089022459 11:115230495-115230517 CAGGGTAACTTTGAAAAGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089022459 Original CRISPR CAGGGTAACTTTGAAAAGGA AGG Intronic
900555642 1:3279062-3279084 CATGTCAACTTTGCAAAGGAAGG + Intronic
900806257 1:4770015-4770037 CAGGCTGGCTTTGAAAAGTAGGG - Intronic
901547668 1:9971246-9971268 CAGATTCACATTGAAAAGGAGGG + Intronic
901953967 1:12770747-12770769 CAGGGGAGCTTGGAAAGGGAAGG + Intergenic
902268715 1:15287827-15287849 CTGGGTTTCATTGAAAAGGAGGG - Intronic
902783388 1:18718230-18718252 AGGGGTAACTTTGGAAAGCAGGG + Intronic
903395108 1:22995052-22995074 CAGTGTGCCTTTGATAAGGATGG - Intergenic
903596036 1:24495560-24495582 AAGGGTGACTTTGAATAGAATGG + Intergenic
903707998 1:25301173-25301195 CAGGGGAACTTGGTAAAGGAGGG - Intronic
903719205 1:25391892-25391914 CAGGGGAAGTTGGTAAAGGAGGG + Intronic
904487568 1:30837398-30837420 AAGGGTGACTTTGAATAGAATGG + Intergenic
907145469 1:52226913-52226935 AAGGGTAACTTTGAATAGAATGG + Intronic
907340883 1:53735556-53735578 CAGGGTAAATTTACAAACGAAGG + Intergenic
907872555 1:58456156-58456178 CAGGGTAACACTGTAAGGGAAGG + Intronic
908786538 1:67739894-67739916 CAGATTATTTTTGAAAAGGATGG - Intronic
908960368 1:69690580-69690602 CAGGGAAGCTTTCATAAGGAAGG - Intronic
910476421 1:87612334-87612356 CAAGGCAACCTTGAAAAGCATGG + Intergenic
910559054 1:88570188-88570210 CAGGGTAACTGAGAAAATAAAGG + Intergenic
912466673 1:109879371-109879393 CAGGGTGACATTGAAAACAATGG - Intergenic
913496568 1:119433263-119433285 CAGGGCAATTTTCACAAGGAAGG + Intergenic
913614930 1:120548981-120549003 CAAGGAAACTCTGAAAAGCAGGG - Intergenic
914575339 1:148961926-148961948 CAAGGAAACTCTGAAAAGCAGGG + Exonic
914890298 1:151615816-151615838 CAGAGTAACTTTGAAATTTAAGG + Intronic
915745839 1:158156990-158157012 AGGGGTAACTTTGAATAGAATGG - Intergenic
916383936 1:164245864-164245886 CAGAGTAACTTGGGAGAGGAGGG + Intergenic
919676376 1:200387554-200387576 CACAGTAACTTTGAGAATGAAGG + Intergenic
923518868 1:234720787-234720809 CAGGGTAACTGTGGAAGGCAGGG - Intergenic
923972353 1:239218644-239218666 CAGGGAAACAATTAAAAGGAGGG + Intergenic
924593272 1:245423273-245423295 CAGGGTTACTGTGAAGATGAAGG - Intronic
1063768394 10:9169250-9169272 CAGGGGACATTTGATAAGGATGG + Intergenic
1063780002 10:9311583-9311605 TGGGGTAACTTTAAAAAAGAAGG - Intergenic
1064465119 10:15571675-15571697 CAGAGGAAGTTTGAAAAGCACGG + Intronic
1064518378 10:16174808-16174830 CTGGGTAAATTACAAAAGGAAGG - Intergenic
1064756926 10:18579896-18579918 AGGGATAACTTTGAAAAGAATGG + Intronic
1066260181 10:33722153-33722175 CTGGGAACCTTTGAAAAAGATGG - Intergenic
1066538823 10:36421804-36421826 TAGGAGAACTTTGAAAAGTATGG - Intergenic
1067811159 10:49428547-49428569 CAGGGTCTCTTTCAACAGGAGGG - Intergenic
1069249817 10:66254573-66254595 CAGTATAGGTTTGAAAAGGAAGG - Intronic
1069478323 10:68757374-68757396 GAAGGTAACTTTGATAAGGATGG + Exonic
1072157695 10:92738763-92738785 CAGGGTAAGTTTGAGAATCAGGG + Intergenic
1073159188 10:101375065-101375087 CAGGGGAACTTAGCAAGGGAAGG + Intronic
1074697580 10:116064525-116064547 CAGGGTAATTATGAAAAAGAAGG - Exonic
1074883988 10:117680486-117680508 CATGGTAACCCTGAAAAGGTAGG + Intergenic
1075493408 10:122894879-122894901 CTAGGAAACATTGAAAAGGAGGG + Intergenic
1077859438 11:6161893-6161915 AGGGGTAACTTTGAATAGAATGG + Intergenic
1077913598 11:6595984-6596006 CAAGGTTACCTTGAAGAGGAAGG + Exonic
1078222754 11:9365079-9365101 AGGGGTAACTTTGAATAGAATGG - Intergenic
1079873231 11:25826254-25826276 CAAGGTAGTTTTGAAAAGAAGGG - Intergenic
1079984972 11:27190599-27190621 GAAGGATACTTTGAAAAGGAGGG - Intergenic
1082058221 11:47838128-47838150 CACTGCAATTTTGAAAAGGATGG + Intronic
1082668529 11:56005445-56005467 AAGGGAAACTTGGAAAAAGAGGG + Intergenic
1083627254 11:64078069-64078091 CAGTGTGACTGTGAAAGGGAAGG - Intronic
1084512448 11:69614645-69614667 CACGGAAACTTTGCAGAGGAGGG + Intergenic
1085573057 11:77576309-77576331 AGGGGTAACTTTGAATAGAATGG - Intronic
1087023290 11:93624495-93624517 AGGGGTAACTTTGAATAGAATGG - Intergenic
1087050199 11:93879132-93879154 AAGGGTGACTTTGAATAGAATGG + Intergenic
1087813944 11:102637945-102637967 GAGGGCAACATTGAAAAGGCAGG - Intergenic
1088103313 11:106177702-106177724 CAGTGAAACTTTGAATAGAATGG - Intergenic
1088563551 11:111142524-111142546 TATGTCAACTTTGAAAAGGAAGG + Intergenic
1089022459 11:115230495-115230517 CAGGGTAACTTTGAAAAGGAAGG + Intronic
1089071437 11:115702345-115702367 CAGGAGAGCATTGAAAAGGAAGG + Intergenic
1089949011 11:122508236-122508258 CATGGTCACTTTGAAAGGGCTGG + Intergenic
1091070332 11:132557089-132557111 CTGGGTATCTATGAAAAGAATGG + Intronic
1091382648 12:72322-72344 GAGGGTAACATTAAAAAAGAGGG + Intronic
1091405570 12:207165-207187 CAGGGTAACCTTCCAAAGCAAGG - Intronic
1091594119 12:1864410-1864432 CAGAGTAACTATGGAAATGACGG - Intronic
1095510496 12:42946398-42946420 AAGGGCAACTTTGAAAATGTTGG - Intergenic
1095900599 12:47324337-47324359 CATGATAACTAAGAAAAGGAAGG - Intergenic
1096872753 12:54604452-54604474 TACTCTAACTTTGAAAAGGAGGG + Intergenic
1099335642 12:81353258-81353280 CAGTGTCACTTTCAAAAGGGTGG + Exonic
1105689767 13:22824718-22824740 CTTGGTAACTTTAAAAATGAAGG + Intergenic
1106856705 13:33861325-33861347 CAGGATGACTTTGAAAAGGGAGG + Intronic
1106951002 13:34883947-34883969 GAGTGTAACTTTGAAAATTATGG - Intergenic
1108265890 13:48708316-48708338 AAGACTAACTGTGAAAAGGAAGG + Exonic
1110331677 13:74280078-74280100 CAGGATAAATTTTAAAAGGAAGG - Intergenic
1112325346 13:98439869-98439891 CCAGGCAACTTGGAAAAGGAGGG - Intronic
1112481157 13:99776676-99776698 CAGGGAAATTTTGAAGAGGTTGG + Intronic
1114296543 14:21334441-21334463 AAGTGTACCTTTGAAAAAGAGGG + Intronic
1114703432 14:24702298-24702320 CAAGGTGATTTTCAAAAGGAAGG + Intergenic
1114870469 14:26649635-26649657 CAGGGGAAGCTTGAAAAGCACGG + Intergenic
1116347365 14:43811897-43811919 CAGGGTATATTAGAAAAAGAAGG + Intergenic
1116743138 14:48782144-48782166 CTTAGTAACTTTGAAAAGAAAGG - Intergenic
1117295516 14:54375550-54375572 CAGGATACATTTCAAAAGGAGGG + Intergenic
1117601234 14:57377292-57377314 AAGTGTAGCTTGGAAAAGGATGG + Intergenic
1118726068 14:68629878-68629900 CAGTCTAACTTTGCAAATGAAGG + Intronic
1118995599 14:70832760-70832782 CAGGAGGACTTTGGAAAGGAGGG + Intergenic
1119247765 14:73127660-73127682 CGGGGTAACTCTGAATAGAATGG - Intergenic
1119383951 14:74245674-74245696 CTGGGTAGCTGTGAAGAGGAAGG + Intronic
1120349364 14:83333063-83333085 CAGGTTAACTTTGCTAAGAAAGG + Intergenic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1121721030 14:96108705-96108727 CAGTGTAGCTGTGAAGAGGAAGG - Intergenic
1122696209 14:103553902-103553924 CAGAGTCACTTGGCAAAGGAGGG - Intergenic
1123812160 15:23938592-23938614 CTGAGTAACTTTAAAAATGAGGG - Intergenic
1123812939 15:23947541-23947563 CAGGATAACATAGAAAAGGCAGG + Intergenic
1123956723 15:25343462-25343484 CAAGGTAACTTTGGAAATAAAGG + Intronic
1125183680 15:36906817-36906839 CAGGATAATTTGGAAGAGGAAGG - Intronic
1125770356 15:42161164-42161186 CAGGCTAATTCTGAAAAGGACGG + Intronic
1126183152 15:45805622-45805644 CAGGGTATCTCTGAAAAGGCAGG - Intergenic
1126818875 15:52481597-52481619 CATGGTAACTTCCTAAAGGAGGG + Intronic
1127733473 15:61820715-61820737 GAGGGAAATGTTGAAAAGGATGG - Intergenic
1127753163 15:62066205-62066227 CAGGTTAGTTTTCAAAAGGAAGG + Intergenic
1128813868 15:70591447-70591469 CTGGGCAACTTAGAAAAGAAAGG - Intergenic
1128832218 15:70779948-70779970 AAAGGTAACTTTGAATAGAATGG + Intergenic
1128904421 15:71454388-71454410 CTGGATAGCTTTGAAAAGAAGGG + Intronic
1130061855 15:80576166-80576188 CAGGGTAACAGCGAAGAGGATGG - Intronic
1130972704 15:88746519-88746541 AAGGATGACTTTGAAAAGAATGG - Intergenic
1135831315 16:25776310-25776332 AGGGGTAACTTTGAATAGAATGG - Intronic
1137022820 16:35446781-35446803 CAGAGTAACTTTAAAAAACAAGG + Intergenic
1137629408 16:49931686-49931708 CAGGGGGACTTTGAAGGGGAGGG - Intergenic
1138232089 16:55345594-55345616 TAGGGTAGATTTGAAAAGTAGGG + Intergenic
1138501575 16:57448245-57448267 CCGCAAAACTTTGAAAAGGAAGG - Intronic
1138684025 16:58708934-58708956 TAGGGTAATTTTGAACAGGTGGG + Intronic
1138930346 16:61647450-61647472 CAGAGTAACGTTGGAAAGGTGGG + Exonic
1138990622 16:62386833-62386855 GAGGGTATCTTTGAAGAGGAGGG + Intergenic
1141890268 16:86921698-86921720 GAGGGCAACTTAGAAAAGCAGGG + Intergenic
1143334518 17:6162358-6162380 CAGGGGACATTTGAAAAGCAGGG - Intergenic
1144236729 17:13268787-13268809 CTGGGTAGCTTTGAAAATGTCGG - Intergenic
1145035672 17:19538895-19538917 CAGGGTCACTGTGACAAGAAGGG + Intronic
1145907015 17:28521773-28521795 CAGGGTAACAGGGAAAATGAGGG - Intronic
1145915232 17:28569947-28569969 CAGGTTAAGTGGGAAAAGGAGGG - Intronic
1146445872 17:32932691-32932713 CAGTGTAACTAGGAAAAGGCAGG + Intronic
1146564123 17:33897147-33897169 TAGGAAGACTTTGAAAAGGAGGG + Intronic
1148817571 17:50341159-50341181 CAGGCTAACTTTGTAATGTAAGG + Intergenic
1151651093 17:75470154-75470176 CAGTGTGCCTTTGAAAATGAAGG + Intronic
1152138683 17:78523422-78523444 CAGGGTAAAATTGAAAAAGGAGG - Intronic
1152254839 17:79232320-79232342 CAATATAACTTTGAAAAAGAAGG + Intronic
1152399449 17:80056697-80056719 CAAGACAATTTTGAAAAGGAAGG + Intronic
1152400051 17:80060577-80060599 CAAGAAAATTTTGAAAAGGAAGG + Intronic
1152771949 17:82175453-82175475 AAGGGTGACTTTGAATAGAATGG - Intronic
1155232158 18:23784326-23784348 CAGGGTAAGGTTGGAAAGAAGGG - Intronic
1155712646 18:28902569-28902591 ATGAGTAACTTTGGAAAGGAAGG + Intergenic
1156555382 18:38062208-38062230 CAGGGTCACTAAGCAAAGGAAGG - Intergenic
1157385095 18:47253684-47253706 CAGGGTAACCTGGAATGGGAGGG - Intergenic
1157813727 18:50716500-50716522 CAGGCTAACTTTGTAGAGGCTGG + Intronic
1158043908 18:53132180-53132202 CAGGGAAAATTTGAAATGGCGGG + Intronic
1159700848 18:71624618-71624640 CCAGGTTACTTTGAAAAGCAAGG + Intergenic
1161612868 19:5252929-5252951 CAGGGGAACTTGGAAAAAGCTGG - Intronic
1162282085 19:9706936-9706958 CAGAGTCACTTTGAAAGGGTTGG - Intergenic
1165300843 19:34967784-34967806 CAGCGTAGCTTTGGAGAGGATGG + Intergenic
1167200720 19:48063410-48063432 GAGGGTGACTTTGAATAGAATGG + Intronic
1167950469 19:53022855-53022877 TGGGGTAACTTTAAAAAAGAAGG + Intergenic
1168654117 19:58114310-58114332 TTGGGAAATTTTGAAAAGGATGG + Intronic
925835145 2:7937671-7937693 CAAGGTGACTTTACAAAGGATGG + Intergenic
926521380 2:13919680-13919702 AAGGGTGACTTTGAATAGAAAGG - Intergenic
926937291 2:18098784-18098806 CATGGTAACTTAGCAAAAGAAGG - Intronic
928834630 2:35529320-35529342 AGGGGTAACTTTGAACAGAATGG + Intergenic
929177024 2:38989283-38989305 CAGAGTAACTTGGATAAAGACGG + Exonic
929318578 2:40512144-40512166 CAGGGAAGCTTTGCAACGGAAGG - Intronic
930414613 2:51075903-51075925 AGGGGTAACTTTGAATAGAATGG + Intergenic
931028446 2:58141800-58141822 CAGGGGAACTGGGAACAGGACGG - Intronic
932656509 2:73615328-73615350 CTGGCTAACTTTGGAAATGAAGG + Intergenic
934547320 2:95228864-95228886 AGGGGTAACTTTGAATAGAATGG - Intronic
935024932 2:99267913-99267935 AGGGGTAACTTTGAATAGAATGG - Intronic
936664026 2:114574261-114574283 CAGGGGAACTTTGAATGGGAGGG - Intronic
936694176 2:114927607-114927629 CAGGATGACTTTGAATAGAATGG + Intronic
938170549 2:129071738-129071760 CTGGGTAACTGTGAGAAGGTTGG - Intergenic
939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG + Intergenic
939730345 2:145776991-145777013 CAGAGAAAATTTAAAAAGGAAGG + Intergenic
939865313 2:147465981-147466003 CAGGGTGACTTTAAGAAGGAAGG - Intergenic
939879652 2:147615527-147615549 CAGGAGAACTTTGAGAAGGGAGG + Intergenic
941746854 2:169095940-169095962 CAAGTTTTCTTTGAAAAGGAGGG + Exonic
943848882 2:192689996-192690018 AAGTGTAACTTTTAAAAAGATGG - Intergenic
944425900 2:199582696-199582718 CTCAGTAATTTTGAAAAGGAAGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945805147 2:214481132-214481154 CAGAGTCACATTGAAAAGGGAGG - Intronic
946183314 2:217961896-217961918 GAGGCTAACCTTGAAAAGGTGGG + Intronic
946238626 2:218340725-218340747 CAGGCTTCCATTGAAAAGGAAGG + Exonic
946701228 2:222416286-222416308 AGGGGTGACTTTGAATAGGATGG - Intergenic
946982772 2:225236086-225236108 CAGGGAAAGATTGAAAAAGAAGG - Intergenic
947969792 2:234313409-234313431 CAGTGTAACAAGGAAAAGGAAGG - Intergenic
948443269 2:238011622-238011644 CAGTGTATCTCTGAAAATGATGG + Intronic
948750202 2:240127755-240127777 CAGAGGGACTTTGAAAATGACGG - Intronic
948879093 2:240846943-240846965 CTGGGTAATTTTTTAAAGGAAGG - Intergenic
1168797432 20:620806-620828 CAAGTTCACTTTGAAAAGGTGGG - Intergenic
1170319154 20:15075650-15075672 CAGGGCAACTGGGAAAATGAAGG - Intronic
1172846566 20:37933078-37933100 CAGGGTCAGTTTGCAAAGGTGGG + Intronic
1172877578 20:38175154-38175176 GAGGGGAACTTTCACAAGGAAGG + Intergenic
1175016946 20:55801840-55801862 CAAGCTGACTTCGAAAAGGAGGG + Intergenic
1175330056 20:58157383-58157405 GAGGGTAACATTTAAAAGCAGGG - Intronic
1175607279 20:60321358-60321380 CAGGGTCACATTGCCAAGGATGG - Intergenic
1176282553 20:64322513-64322535 GAGGGTAACATTAAAAAAGAGGG - Intergenic
1177365651 21:20132379-20132401 AAGGGTGACTTTGAATAGAATGG + Intergenic
1177458794 21:21381557-21381579 CAAGGAAACTTTGAAAATGTAGG - Intronic
1179587317 21:42381779-42381801 CAGGGTAACATTGAAAATGTAGG + Intronic
1182073947 22:27482139-27482161 CAGGGGAATTTGGAAAGGGAAGG - Intergenic
1182608571 22:31527264-31527286 CGGGGTAACTATAAAAAGTAAGG - Intronic
1183007696 22:34916907-34916929 AAGGGTGACTTTGAATAGAATGG - Intergenic
1183170235 22:36182501-36182523 AAGGCTGACTTTGAAGAGGAAGG - Intergenic
1183851366 22:40591338-40591360 AAGTGTAACCTTGAAAAGAAGGG - Intronic
1184378394 22:44129563-44129585 CAGGGCAGCTTGGAGAAGGAAGG - Intronic
949506700 3:4735220-4735242 CAGTGTCACCTTGACAAGGAGGG + Exonic
949622229 3:5826308-5826330 CATGTTAAATTTGAAAAGGTAGG - Intergenic
950215766 3:11157455-11157477 CAGCGTCACTGTGAAAGGGAGGG - Intronic
950828099 3:15846789-15846811 CAGAGCAACTTTGGAAATGAGGG - Intronic
951231795 3:20187628-20187650 CTGGTTAACTTGGAAAACGAGGG - Intergenic
951254848 3:20436951-20436973 AAGGGTAAAGTTGAAATGGAAGG + Intergenic
951281422 3:20754368-20754390 GAGGGAAACTTTGAAAAGCAGGG - Intergenic
951447472 3:22799196-22799218 CAAGATAACCTAGAAAAGGATGG - Intergenic
953293119 3:41686340-41686362 CAGGGTTTCTTGGAAGAGGAAGG + Intronic
953872679 3:46641154-46641176 AAGGGAAACATTGATAAGGAAGG - Intergenic
954914352 3:54136027-54136049 CTGGGTAGCTTTGAAAGGCATGG - Intronic
956019954 3:64923615-64923637 GTGGGTAACTTTGGGAAGGAAGG + Intergenic
956722439 3:72130133-72130155 CAGGGATATTTTGAAAAGCATGG + Intergenic
957151636 3:76493797-76493819 CATGATAACTTTGAGAAGAAAGG - Intronic
958955461 3:100461210-100461232 AAGGGTGACTTTGAAGAGAACGG - Intergenic
959179044 3:102955292-102955314 CAGGGTAATTTTTATAAAGAAGG + Intergenic
959338962 3:105103355-105103377 CAAGGTAACTTTTGAAAAGAGGG + Intergenic
959705021 3:109331715-109331737 AAAGGTAACTTTTTAAAGGATGG - Exonic
961740609 3:129031120-129031142 CAGGGTCACCTTTAAAAGCATGG + Intronic
962104915 3:132380505-132380527 GGGGGTAACTATTAAAAGGAAGG - Intergenic
962753027 3:138448612-138448634 CAGAGTAACTTTGAGAATGTGGG + Intronic
964194499 3:154046915-154046937 AAGGGTAACTTGAAAAAGAAGGG + Intergenic
965795644 3:172436058-172436080 CATGCTTTCTTTGAAAAGGAGGG + Intergenic
967142692 3:186574991-186575013 AAGGCAAATTTTGAAAAGGATGG + Intronic
967777135 3:193396223-193396245 CTGGGTAACTTATAAAAGAAAGG + Intergenic
969322610 4:6421785-6421807 CAGGGTAACTGTGAAGTGGGTGG - Intronic
970719784 4:18973021-18973043 CAAAATAACTTTCAAAAGGATGG - Intergenic
971004916 4:22362523-22362545 CAGGGTCTTTTTGAAAGGGAGGG - Intronic
971913207 4:32823624-32823646 AAGGATAACTTTGAATAGAATGG + Intergenic
972358493 4:38304611-38304633 CAGGTTAAATGTGAATAGGATGG + Intergenic
976746712 4:88410391-88410413 AAGGGTGACTTTGAACAGAATGG + Intronic
977504427 4:97883912-97883934 CAGGATAAATAGGAAAAGGAAGG + Intronic
978497581 4:109376707-109376729 CAGGGTATCTGTAAAATGGAGGG + Intergenic
978644139 4:110908549-110908571 AAGGGTCATTTTGAAACGGAAGG + Intergenic
978749166 4:112227822-112227844 CAAGAGAATTTTGAAAAGGATGG + Intergenic
978912959 4:114086757-114086779 CAGGAAATTTTTGAAAAGGATGG + Intergenic
980215554 4:129848845-129848867 CAAGGCAATTTTGAAAAGTAAGG + Intergenic
981772961 4:148331033-148331055 CTGGGTAATTTTATAAAGGAAGG - Intronic
982071651 4:151700735-151700757 CCAGGCAGCTTTGAAAAGGATGG + Intronic
982108238 4:152029812-152029834 CGTGGTAACTTTGACCAGGATGG - Intergenic
985227291 4:187775497-187775519 AGGGGTAACTTTGAATAGAATGG + Intergenic
986192434 5:5509781-5509803 CTCTGTGACTTTGAAAAGGAGGG - Intergenic
986717582 5:10535161-10535183 CTGTGTAGCTGTGAAAAGGAAGG + Intergenic
987476225 5:18395060-18395082 TATGGGAACTTTGAAAAGGCAGG - Intergenic
988354630 5:30157915-30157937 CAGTCTAACTTTGGAGAGGAAGG - Intergenic
989641754 5:43589769-43589791 AGATGTAACTTTGAAAAGGATGG + Intergenic
990694136 5:58396187-58396209 CAAACTAATTTTGAAAAGGAAGG + Intergenic
991275066 5:64836985-64837007 CAGGAAAAGTTTCAAAAGGATGG + Intronic
992127669 5:73658379-73658401 GAGGGTAACACTGAAAAGGGAGG + Intronic
992563260 5:77972964-77972986 CAGGGGAGAATTGAAAAGGAAGG - Intergenic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
992810412 5:80382201-80382223 CAGGGTGACTCTGAAAGGGTGGG - Intergenic
993689433 5:90981342-90981364 AGGGGTAACTTTGAATAGAATGG + Intronic
994300586 5:98142473-98142495 CATGGTAGCTTTGACAAGGAAGG - Intergenic
994609551 5:102019033-102019055 CAGGGTATCTCTGAAAAAAATGG + Intergenic
994636133 5:102346314-102346336 CAGGGTAACTGGGTAAAGGATGG - Intergenic
997510192 5:134448709-134448731 CAGGGAGACTATAAAAAGGATGG - Intergenic
997737480 5:136224721-136224743 GAGGGTAACTTTGCCCAGGAGGG - Intronic
998172703 5:139881884-139881906 CAGGGAAACTCTGAGAAGGAAGG - Intronic
998328476 5:141303372-141303394 AAGGGTATCCTTAAAAAGGATGG - Exonic
999226387 5:150028288-150028310 GAGGGTGACTTTGAATAGAATGG + Intronic
1000150774 5:158498476-158498498 CTGGGAAAATGTGAAAAGGAAGG - Intergenic
1000496921 5:161995618-161995640 CAAGGTAACTTTGCAAAAGTTGG - Intergenic
1000730268 5:164826481-164826503 GAGGATAACTTTGAATAGAATGG + Intergenic
1001855239 5:175004945-175004967 CAGGATACCTGTGAAAAGAAAGG + Intergenic
1001948573 5:175800012-175800034 CAGGGCAAATCGGAAAAGGAAGG - Intronic
1002403613 5:179010931-179010953 AAGGATAACTTTGAACAGAATGG - Intergenic
1003640499 6:7871539-7871561 CAGGGCAACTTGGACAAGCAGGG - Intronic
1005446613 6:25930577-25930599 AAGGCTAACTTGGAAAAGGAGGG + Exonic
1005640272 6:27789374-27789396 AAGGTTAATTTTGAAAAGAATGG - Intergenic
1008381556 6:50843888-50843910 GAGGGTAACATGGAAAAGGGTGG - Exonic
1008910492 6:56727083-56727105 GAGGGTGACTTTGAATAGAATGG - Intronic
1009242343 6:61197920-61197942 CTGGGTAACTTACAAAAGGAAGG - Intergenic
1010023688 6:71190781-71190803 CTGGGTAACTTTGAGAGTGAAGG - Intergenic
1012855522 6:104496850-104496872 TTGGGTGACTTTGAAAAAGATGG - Intergenic
1013473449 6:110486533-110486555 CAGGGACACTTTGAATAGAAAGG - Intergenic
1014305068 6:119730007-119730029 CAGGAAAACCATGAAAAGGAAGG - Intergenic
1014887465 6:126799023-126799045 AGGGGTAACTTTGAATAGAATGG + Intergenic
1014912480 6:127111431-127111453 CAGGGGATTTTTGATAAGGATGG + Intergenic
1015291110 6:131539029-131539051 CAGGGTATCTCTGAAAAAAAAGG + Intergenic
1016426808 6:143943851-143943873 CAGTGGAACTATGAAAAAGATGG - Intronic
1017010360 6:150059249-150059271 GAGGGAAACTTTGTCAAGGAAGG - Intergenic
1017152072 6:151289779-151289801 CAGGTTAACTTTGTAAAGGGAGG + Intronic
1019030686 6:169008273-169008295 AGGGGTAACTTTGAATAGAATGG + Intergenic
1019056804 6:169229627-169229649 CAGGAAGACTTTGACAAGGACGG - Exonic
1019624566 7:2009420-2009442 CACGGTCACGTGGAAAAGGATGG + Intronic
1019852525 7:3573778-3573800 CAGCATGACTTAGAAAAGGAAGG - Intronic
1023166942 7:37352407-37352429 AAAGGAAACTTTGAAAAGAACGG - Intronic
1023300283 7:38762920-38762942 CAGGGTAACTTTGACGATAAAGG + Intronic
1024719165 7:52115703-52115725 GGGGGTAACTTTGAATAGAATGG - Intergenic
1025640886 7:63367603-63367625 CAGCATAACTCTGACAAGGAAGG + Intergenic
1029233660 7:99093349-99093371 GAGAGTGGCTTTGAAAAGGAAGG - Intronic
1030573176 7:111252149-111252171 CATGTGAACTTTGAAAAGAAGGG - Intronic
1030854496 7:114536353-114536375 CAGGGTATCTCTGGAAAGAATGG + Intronic
1031016869 7:116585051-116585073 CAGGGTAACTTTTAGAAGACAGG + Intergenic
1032500892 7:132398849-132398871 AAGTGTCACTTTGAAAGGGAGGG + Intronic
1032622189 7:133546634-133546656 TAGGGAACTTTTGAAAAGGAAGG - Intronic
1034196554 7:149252753-149252775 CTGGGTGACTTGGAAGAGGAAGG + Exonic
1034873802 7:154706835-154706857 GTGGGTGACTCTGAAAAGGAAGG + Intronic
1035495724 7:159324120-159324142 GAGGGTAACTTTGAATAGAATGG - Intergenic
1039252778 8:35684825-35684847 GAGGGTAACTTTGGAAAAGAAGG - Intronic
1041344109 8:56878040-56878062 CAGTGTAACTGTCAAAAAGAGGG - Intergenic
1041383144 8:57273131-57273153 CAGGGCACCTCTGAAAAGAAAGG - Intergenic
1041772584 8:61487832-61487854 CAGGATGAGTTTGAAAAGGATGG - Intronic
1042188691 8:66164108-66164130 CAAGGTAACTTTAAAAAGACAGG + Intronic
1045902446 8:107299316-107299338 CAGGTTAACTTTCTAAAGTAGGG + Intronic
1046146683 8:110170636-110170658 GAGGCTGACTTTGAAAAAGATGG - Intergenic
1048237259 8:132703287-132703309 CAGGGTAACTTGGGAGTGGAGGG - Intronic
1048398930 8:134045049-134045071 CAGGGGAACTATAAAAAGTATGG + Intergenic
1050005555 9:1125920-1125942 CAGGGTGAACTTGAAAAGAAAGG - Intergenic
1050922895 9:11228602-11228624 AAGGATAACTTTGAACAGAATGG + Intergenic
1051459896 9:17300048-17300070 CAGTGTAACTTTGAAAGTCAAGG - Intronic
1052536075 9:29749203-29749225 GAGGTTAACTACGAAAAGGATGG + Intergenic
1056774528 9:89501217-89501239 CAGAGAAACTTTGCAAAGCATGG - Intergenic
1057026531 9:91738227-91738249 AAGGGAAACTATGAGAAGGAGGG + Intronic
1057292516 9:93815705-93815727 CATGAAAACTTTGAAAAGGCAGG - Intergenic
1057827907 9:98385140-98385162 CAGAGTAACATAGAAAAGGAGGG - Intronic
1058384311 9:104415622-104415644 AAGGGTGACTTTGAATAGAATGG - Intergenic
1059136167 9:111808504-111808526 CAGGGTGAGTTTGAATAGAATGG - Intergenic
1059944357 9:119393717-119393739 CAAGGAAACTTTGGAATGGAGGG - Intergenic
1060254118 9:122011911-122011933 CAGGGTTAATTTCAGAAGGAAGG + Intronic
1062330762 9:136043715-136043737 CAGGGTAACATTCTACAGGAGGG + Intronic
1185811476 X:3114448-3114470 AAGGGTGACTTTGAATAGAATGG + Intergenic
1185941320 X:4322839-4322861 CAGCATATGTTTGAAAAGGAAGG + Intergenic
1186147697 X:6641969-6641991 AAGGGTGACTTTGAATAGAATGG - Intergenic
1186291876 X:8109115-8109137 AGGGGTAAGATTGAAAAGGAAGG - Intergenic
1187686572 X:21821516-21821538 CAGGCTAAGTTTGACAAGAATGG - Intergenic
1189373932 X:40451638-40451660 CAGGGGAACATTAGAAAGGAAGG - Intergenic
1190618594 X:52263239-52263261 GAGAGTAGCTTTGAGAAGGAGGG - Intergenic
1192296233 X:69851922-69851944 CATGCTAAGTTTGAAAAGCACGG + Intronic
1194205407 X:91005724-91005746 AGGGGTGACTTTGAAAAGAATGG + Intergenic
1194368367 X:93037521-93037543 AGGGGTGACTTTGAAAAGCATGG + Intergenic
1194507479 X:94750602-94750624 GAGGGTAACTTTGAATAGAATGG + Intergenic
1194810826 X:98384967-98384989 CGGGGTGACTTTGAATAGAATGG + Intergenic
1195540117 X:106054080-106054102 CAGGGTGACTTTGAATAGAATGG - Intergenic
1196401068 X:115317408-115317430 AAGGATAACTTTGAATAGAATGG + Intergenic
1196596080 X:117547063-117547085 CAGAGTAACATTGAAGAGGTAGG + Intergenic
1196773278 X:119316924-119316946 AAGGGTGACTTTGAATAGAATGG - Intergenic
1199002932 X:142662063-142662085 CAGGGTAATTTATAAAAGTAAGG - Intergenic
1199360882 X:146917119-146917141 CTGGGTAATTTTTAAAAGAAAGG + Intergenic
1199868613 X:151876553-151876575 AGGGGTAACTTTGAACAGGATGG - Intergenic
1200551224 Y:4580867-4580889 AGGGGTGACTTTGAAAAGAATGG + Intergenic