ID: 1089026247

View in Genome Browser
Species Human (GRCh38)
Location 11:115273262-115273284
Sequence CTAGACAGTGATGATGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089026247_1089026248 2 Left 1089026247 11:115273262-115273284 CCTAAGACATCATCACTGTCTAG 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1089026248 11:115273287-115273309 AAAGAATGTCTATACTACAGTGG 0: 1
1: 1
2: 1
3: 13
4: 204
1089026247_1089026249 5 Left 1089026247 11:115273262-115273284 CCTAAGACATCATCACTGTCTAG 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1089026249 11:115273290-115273312 GAATGTCTATACTACAGTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089026247 Original CRISPR CTAGACAGTGATGATGTCTT AGG (reversed) Intronic
900720705 1:4174141-4174163 TAAGATAGTGATGATGACTTGGG - Intergenic
901075224 1:6550505-6550527 ATACACAGAGAAGATGTCTTGGG + Exonic
903348569 1:22703809-22703831 CTGGTCTGTGATGAGGTCTTTGG + Intergenic
906815927 1:48878592-48878614 ATATACAGTGATAATGTCTGTGG - Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
907874354 1:58471449-58471471 TTAGACATTCATGATGTCTCGGG + Intronic
907960476 1:59275565-59275587 ATAAACAGTTATGATGTGTTTGG - Intergenic
908344068 1:63213577-63213599 CTAGATAGAGATGAGGTCTCAGG - Intergenic
913049220 1:115101534-115101556 CTATACAGTCATGATGTATTAGG - Intergenic
917150222 1:171935506-171935528 CAAAACATTGATGAGGTCTTGGG + Intronic
919852584 1:201683238-201683260 CTAAACAGGGATTATGTGTTTGG + Intronic
922682575 1:227612900-227612922 TCAGACACTGATGATGTTTTTGG - Intronic
1063719818 10:8568701-8568723 CTAAACAGTGATCAAGGCTTGGG - Intergenic
1064105648 10:12498767-12498789 AATGACTGTGATGATGTCTTGGG - Intronic
1066122322 10:32301552-32301574 CAAGACAGCGATATTGTCTTGGG + Intronic
1068365010 10:56036734-56036756 CTGGACAGTGAGGAAGTTTTAGG + Intergenic
1069273779 10:66564483-66564505 ATAGAAAGTGATGATGCCATTGG + Intronic
1070639159 10:78153989-78154011 CTAGGAAGTGATTATGTTTTTGG + Intergenic
1073923164 10:108482036-108482058 CTAGAGAGAGATAATCTCTTTGG + Intergenic
1076124390 10:127962692-127962714 CCAGACACTGCTGATGTCCTGGG - Intronic
1079494509 11:21026514-21026536 TTAGACAGTGATGATTGCTGTGG - Intronic
1086251879 11:84825630-84825652 CTACACAGTGAGGATATCTCTGG - Intronic
1086927889 11:92660396-92660418 CTAGAAAGTGATGAAGGCTGGGG + Intronic
1089026247 11:115273262-115273284 CTAGACAGTGATGATGTCTTAGG - Intronic
1090215160 11:124955217-124955239 GTAGATAGTGCTTATGTCTTGGG - Intronic
1090592101 11:128283235-128283257 CCAGATAGTGATGATTCCTTAGG + Intergenic
1092275703 12:7059565-7059587 CTCACCAGTGGTGATGTCTTAGG - Intronic
1092621283 12:10272590-10272612 CTGGACAGTGCTGATGTCTCTGG + Intergenic
1094620848 12:32078946-32078968 CTCTACAGTTCTGATGTCTTAGG + Intergenic
1095278156 12:40315559-40315581 CTAGATCCTGATGATGTCATTGG + Intronic
1098774216 12:74590659-74590681 CTCAAAAGTGATGATTTCTTTGG + Intergenic
1099588977 12:84561271-84561293 GTAAACAGTGCTGATGTATTTGG + Intergenic
1100855079 12:98750932-98750954 GTACACAGTGATGATGTCCTCGG - Intronic
1106439330 13:29751511-29751533 CAAGGCAGTGATCATGGCTTGGG - Intergenic
1106606711 13:31235223-31235245 TTAGAGGGTGATGATGACTTTGG + Intronic
1108094184 13:46883195-46883217 CTAGACAGTGCAGATGTTTCAGG - Intronic
1108853760 13:54767981-54768003 GTGGACAGTGCTGATATCTTTGG + Intergenic
1113825082 13:113246372-113246394 GTAGACAGTGCTGAAGTCTTGGG + Intronic
1114339568 14:21728953-21728975 CTCCACAGTGTTGGTGTCTTAGG - Intergenic
1116165701 14:41331921-41331943 ATAGACAGTGTGGATGCCTTGGG + Intergenic
1117517692 14:56518695-56518717 TTAGATATTGATGGTGTCTTTGG - Intronic
1117946292 14:61026100-61026122 ATAAACTGTAATGATGTCTTAGG + Intronic
1118157229 14:63254166-63254188 ATAGACAGTGATGGAGTGTTTGG - Intronic
1119985940 14:79137449-79137471 CTAGACATTGTTTATGTCTCAGG - Intronic
1120936451 14:89900323-89900345 CAGGACAGTGATGATCTCTAGGG + Intronic
1120950017 14:90032291-90032313 CCCAACAGTGCTGATGTCTTAGG - Intronic
1121177976 14:91905428-91905450 CTAGACACTGACGATGACCTAGG + Intronic
1121579604 14:95017902-95017924 CTAGTCATTGATGATATCATGGG - Intergenic
1122090892 14:99339492-99339514 CTAAACAGAGATGAAGTCTGAGG - Intergenic
1122572726 14:102718399-102718421 GTAGAGGTTGATGATGTCTTGGG - Intronic
1125204035 15:37130771-37130793 CTAGACACTGATCCTATCTTTGG + Intergenic
1128906904 15:71475431-71475453 CCAGACAGTGGTGGTGTATTAGG + Intronic
1129091030 15:73151264-73151286 CTAAACAGTGTTGATTTCCTGGG + Intronic
1129931522 15:79415052-79415074 ATAAACAGTGATGCTGTGTTGGG + Intronic
1129945618 15:79537175-79537197 TAAGACAGTGATGATGTAGTAGG - Intergenic
1131087706 15:89590866-89590888 TTAGACATTAATGAAGTCTTGGG - Intronic
1131342144 15:91612295-91612317 CAAGGAAGTGATGATGTCTCAGG - Intergenic
1132003753 15:98207387-98207409 CTATACAGTGATGAAGGCTGCGG - Intergenic
1133382205 16:5340858-5340880 CCAGACAGTGATGAGGACTCAGG + Intergenic
1133830094 16:9315010-9315032 CTAGATAGTGGTGAGCTCTTGGG - Intergenic
1134651516 16:15912649-15912671 CTAGATAGTGATGATAGCTGTGG - Intergenic
1134789767 16:16978987-16979009 CAAGACAGTGATGTTCTCTGGGG + Intergenic
1135263463 16:21001008-21001030 CCAGGCAGTGATGATGGCATAGG - Intronic
1142714081 17:1738492-1738514 CTAGACAGAGATGAGGTCCAGGG + Exonic
1142720669 17:1773751-1773773 CTAGGCTGTGGTGATGTGTTTGG + Intronic
1149044957 17:52234355-52234377 CTAGACAGGGATGTCCTCTTAGG - Intergenic
1149775410 17:59353259-59353281 CCACACACTGGTGATGTCTTCGG - Exonic
1153376716 18:4388720-4388742 CTTTACAGTTAAGATGTCTTTGG - Intronic
1154007723 18:10546901-10546923 CTACACTGTGATGATGGCTCAGG + Intronic
1155686972 18:28565465-28565487 CTAGTCAATGATGATGTCTTTGG + Intergenic
1156269318 18:35516459-35516481 ATATGCAGTGATGATGTCTGGGG - Intergenic
1156275245 18:35577847-35577869 CATGACAGCGATGATGTCTACGG + Intergenic
1162869914 19:13578480-13578502 TTAGAGAGTGGTGAGGTCTTTGG - Intronic
1164061043 19:21674045-21674067 CAAGAAAGTGACGATGTCCTCGG - Intergenic
1164065625 19:21713649-21713671 CAAGAAAGTGACGATGTCCTCGG + Intergenic
1164090235 19:21944841-21944863 CAAGAAAGTGACTATGTCTTTGG + Intronic
1164194363 19:22942649-22942671 CAAGAAAGTGACTATGTCTTTGG + Intergenic
1164222311 19:23205932-23205954 CAAGAAAGTGATCATGTCCTTGG + Intergenic
1168510875 19:56972708-56972730 CAAGGCAGTGATGATGTTTGAGG + Intergenic
925214473 2:2082872-2082894 CTAGTCAGGCATGAGGTCTTGGG - Intronic
925657946 2:6169483-6169505 CTCGACTGTGAAAATGTCTTTGG - Intergenic
925931709 2:8713540-8713562 CAAGGCAGTGGTGCTGTCTTTGG + Intergenic
926780422 2:16466119-16466141 ATGGCCAGAGATGATGTCTTAGG - Intergenic
930892872 2:56411534-56411556 CTAGACAGTGAGGTTATTTTAGG - Intergenic
931921122 2:67016834-67016856 CTAGAAAGATATGTTGTCTTGGG - Intergenic
935428055 2:102942118-102942140 TTAGAAAGTGAAGATGTCATTGG - Intergenic
936646963 2:114383279-114383301 CAAGGAAGTGACGATGTCTTTGG + Intergenic
938605170 2:132884639-132884661 CTACAAAGTCATGATTTCTTTGG + Intronic
938910485 2:135880921-135880943 TTAGACAGTGATTATGGGTTAGG + Intergenic
942897198 2:181071420-181071442 CTAGACCATGATGACCTCTTTGG - Intronic
946028879 2:216689750-216689772 CTTGACTGTGATGATGGCTATGG + Intronic
1170136735 20:13082899-13082921 GCAGACATTGATGATGTCCTTGG - Intronic
1170570158 20:17628095-17628117 CTCGACTGTGAAGAGGTCTTGGG - Intronic
1170902171 20:20474785-20474807 GTATCCAGTGATGATGTATTGGG + Intronic
1171095842 20:22331786-22331808 CTAGACATTGATGCTCCCTTGGG + Intergenic
1172159027 20:32852203-32852225 CAAGACAGAGATGATGATTTTGG + Intergenic
1172434867 20:34921631-34921653 CTAGGCAGGGATGGTGTCTTGGG + Intronic
1172741725 20:37173864-37173886 CTAGACTTTGATGATGAATTTGG - Intronic
1173813029 20:45968000-45968022 CTGGACATTGGTGATGTCATGGG + Exonic
1179100775 21:38354054-38354076 CTAGAAAGCAATGATGTCTTCGG + Intergenic
1181515438 22:23408789-23408811 CTAGACAGCGGTGATGGCTGAGG + Intergenic
1182482363 22:30617366-30617388 CGTGACACTGATGATCTCTTGGG - Exonic
1183969282 22:41464217-41464239 GGAGACAGGGATGATGTCTATGG - Intronic
949855878 3:8460623-8460645 CTAGAGAGTGGTGAAGTTTTGGG - Intergenic
950841062 3:15968968-15968990 CCAGACACTGATGATGCCTTTGG - Intergenic
950852408 3:16075088-16075110 CAAGACAGTGCTGATGACATTGG - Intergenic
951635468 3:24770139-24770161 CTAGACTGTGGTGGTTTCTTGGG - Intergenic
964818363 3:160741572-160741594 CTACTCAGTGAAAATGTCTTTGG - Intergenic
969505250 4:7582703-7582725 CAAGACACTGATTATGTCTCAGG - Intronic
970768213 4:19577030-19577052 ATCGACAGTGATGTTGACTTGGG + Intergenic
972150021 4:36077840-36077862 CAAGACAGTGATGATGTCTCAGG + Intronic
972565281 4:40264047-40264069 CTAGACAGAGTTGATTTCTCAGG + Intergenic
973036666 4:45415747-45415769 CAAGACAGTGAAGGTGTATTGGG - Intergenic
975193560 4:71495692-71495714 AAAGACATTGATGATGTGTTTGG + Intronic
979181160 4:117729239-117729261 TTAGAGAGTGATGCTGGCTTAGG - Intergenic
981185296 4:141794774-141794796 CTAAACAGTTATGATGTTCTGGG + Intergenic
981232267 4:142370175-142370197 ATAGACATTGGTGATGACTTGGG - Intronic
985319117 4:188689150-188689172 CTAGAGAGTGATGATGTGTATGG + Intergenic
989671392 5:43921114-43921136 CTAGCCACTGATGATTTCTGTGG + Intergenic
990663906 5:58050666-58050688 CAACACAGTAATGAGGTCTTGGG + Intergenic
990747717 5:58977960-58977982 CTTCACAGTGATGTTGTGTTTGG + Intronic
993660594 5:90629225-90629247 CAGGATAGTGATGATGTCTATGG + Exonic
999191065 5:149747846-149747868 GAGGACAGTGATGGTGTCTTGGG + Intronic
1000029942 5:157393124-157393146 CTAGGGAGTGGTGATGTGTTTGG - Exonic
1001646642 5:173287187-173287209 CTAGACAGTGATGACGCATCTGG + Intergenic
1011702413 6:89968063-89968085 CTAGGCAGTGGTCATGGCTTGGG - Intronic
1011858834 6:91729453-91729475 GGAGACAGTGAAGCTGTCTTAGG - Intergenic
1012435997 6:99215842-99215864 CTTGACTGTGTTGATGTCTCAGG - Intergenic
1015441181 6:133248609-133248631 GTTGAAAGTGATGATGACTTGGG + Intronic
1016153099 6:140768560-140768582 ATAGACACTGATGATCTATTTGG + Intergenic
1016279507 6:142399227-142399249 CTAGACTGTGATTATGGCCTTGG - Intronic
1025006016 7:55355509-55355531 CTTGACAGAGATCCTGTCTTTGG - Intergenic
1027056986 7:75056461-75056483 CCAGACATTGTTGATGTGTTTGG - Intronic
1032500469 7:132396016-132396038 ATAGACAGTGATGTTGCCTGGGG + Intronic
1033505419 7:141994947-141994969 CAATACAGTGATGTTATCTTTGG + Intronic
1035358154 7:158291616-158291638 CTGGACAGTGCTGCTGTCTTTGG + Intronic
1038673105 8:29598062-29598084 ATGTTCAGTGATGATGTCTTTGG + Intergenic
1042350351 8:67770995-67771017 ATAGACAGAGTTGATGTCCTTGG - Intergenic
1043951889 8:86318637-86318659 CTTCATAGTGATGACGTCTTAGG - Intronic
1045265596 8:100616314-100616336 GAAGTCAATGATGATGTCTTTGG + Intronic
1045903850 8:107318247-107318269 ATAGACAATAATGGTGTCTTAGG - Intronic
1046272428 8:111914492-111914514 CTAGATAATGATGTTGGCTTAGG - Intergenic
1050014414 9:1218824-1218846 CTAGACAGTGACCATCTCTTTGG + Intergenic
1050068421 9:1785618-1785640 CTAGACAGAGAAGAGGTCTCAGG - Intergenic
1050296594 9:4211346-4211368 CTTTTCAGTGATGCTGTCTTAGG - Intronic
1051433275 9:17002687-17002709 CTAGACAGTGTGGAATTCTTTGG + Intergenic
1059280160 9:113126081-113126103 CTGGACAGTGAAGATCTCTGAGG + Intergenic
1060522252 9:124300515-124300537 CTGGAGAGAGATGACGTCTTTGG + Intronic
1062291141 9:135794985-135795007 CTAGGCAGTGATGACTTCTTAGG - Intergenic
1186521951 X:10213942-10213964 CTCGACAGTCATGCTGTCCTGGG - Exonic
1187895594 X:23977071-23977093 GTGAAGAGTGATGATGTCTTGGG - Intergenic
1192397785 X:70800627-70800649 CTGAACAGTGGTGATTTCTTAGG + Intronic
1196117814 X:112016158-112016180 CTAGACAGAGATGATGAGGTTGG + Intronic
1196665529 X:118311883-118311905 CTAAACATTCATGGTGTCTTTGG - Intergenic
1197019224 X:121666572-121666594 TTAGACAGTGGTGATGGCTGTGG + Intergenic
1200702864 Y:6417049-6417071 CTAGGCAGTGGTGATATTTTTGG + Intergenic
1201031246 Y:9747648-9747670 CTAGGCAGTGGTGATATTTTTGG - Intergenic
1201735101 Y:17251317-17251339 CTTGTCAGTGAAGATGGCTTAGG + Intergenic