ID: 1089028605

View in Genome Browser
Species Human (GRCh38)
Location 11:115298376-115298398
Sequence AAGAAGAAAGGGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11771
Summary {0: 1, 1: 9, 2: 142, 3: 1536, 4: 10083}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089028605 Original CRISPR AAGAAGAAAGGGAAGGAGGC AGG Intronic
Too many off-targets to display for this crispr