ID: 1089030262

View in Genome Browser
Species Human (GRCh38)
Location 11:115319376-115319398
Sequence ATGGTGAAGCAGAAAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 759
Summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 687}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089030257_1089030262 16 Left 1089030257 11:115319337-115319359 CCATGAGATGACCATCAGTAAAA 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG 0: 1
1: 0
2: 6
3: 65
4: 687
1089030258_1089030262 5 Left 1089030258 11:115319348-115319370 CCATCAGTAAAAAAGTCACCAAC 0: 1
1: 0
2: 1
3: 13
4: 180
Right 1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG 0: 1
1: 0
2: 6
3: 65
4: 687
1089030256_1089030262 26 Left 1089030256 11:115319327-115319349 CCATCTTGGACCATGAGATGACC 0: 3
1: 2
2: 24
3: 61
4: 254
Right 1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG 0: 1
1: 0
2: 6
3: 65
4: 687

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089030262 Original CRISPR ATGGTGAAGCAGAAAAAAGA AGG Intronic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
902091935 1:13910536-13910558 ATGGTGAAGCAGGAGCAAGGTGG - Intergenic
902999184 1:20252603-20252625 TTGATGACACAGAAAAAAGATGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903155944 1:21443022-21443044 ATGGTGCAGAAGGAAAAGGATGG - Intronic
903242442 1:21992436-21992458 AAGGTGAAGCAGGAACATGAAGG + Intronic
903245952 1:22015621-22015643 AAGGTGAAGCAGGAACATGAAGG + Intergenic
903338093 1:22637993-22638015 AAGGTGAAGCCGAAGAAAGAGGG - Intronic
905146513 1:35891352-35891374 ATGGTAATGGAGAAAAAATAGGG + Intronic
906294745 1:44642711-44642733 ATGGCAAAGCAGAGAAAACAGGG - Intronic
906575408 1:46885018-46885040 ATGGGGACTCAGAGAAAAGATGG - Intergenic
906596568 1:47082877-47082899 ATGGGGACTCAGAGAAAAGATGG + Intronic
906873673 1:49512549-49512571 ATGGTGAAGTAGGAAAGAGGGGG - Intronic
907203382 1:52747455-52747477 ATGGTGTAGCAGAAAAAGTATGG + Intronic
907535851 1:55155922-55155944 ATGTTGGAGAAGCAAAAAGAAGG - Intronic
907560045 1:55379868-55379890 ATTGTGAAGCATATAAAATAAGG - Intergenic
907699620 1:56772368-56772390 ATTGTTAAGAGGAAAAAAGAAGG + Intronic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
907804827 1:57807790-57807812 AGGGAGGAGGAGAAAAAAGAGGG - Intronic
908206538 1:61856082-61856104 ATGGTGTAGCAGAAAGAAGTGGG + Exonic
908990436 1:70081364-70081386 ATGCCAAAGCAGAAATAAGAAGG + Intronic
910064244 1:83134375-83134397 GTGCTGGAGTAGAAAAAAGAAGG + Intergenic
910126210 1:83845352-83845374 ATGAAGATGCAGGAAAAAGAGGG + Intergenic
910338751 1:86162077-86162099 ATCCTGAAGCAGGAAAAAGAAGG - Intergenic
910451991 1:87356677-87356699 ATGGTGAAGCAAAACAAAGATGG + Intergenic
911402061 1:97387762-97387784 ATGTTCAAGGGGAAAAAAGAAGG + Intronic
911406355 1:97445283-97445305 AAGGTGAAGCAGAGACATGAAGG - Intronic
912103147 1:106236498-106236520 ATGGTGAACCTGTAAAAAAAGGG + Intergenic
912667742 1:111598143-111598165 ATGGTATAGCAGAAAGAACAGGG - Intronic
914997877 1:152560796-152560818 ATTGTGAAGCTGAACAAAGCTGG + Intronic
915729631 1:158043865-158043887 AGGGTGAAGCTGGAAAAATAGGG - Intronic
915994858 1:160552016-160552038 AGGGTCAAGGTGAAAAAAGAAGG + Intronic
916105769 1:161430437-161430459 ATGATGAGGCAGAAAAAAGGTGG + Intergenic
916275394 1:162988370-162988392 AGGGTGAAGAAGGAAAAGGAGGG + Intergenic
916686571 1:167152563-167152585 CTGGTGAAGCAGCAAAGGGATGG - Intergenic
917481278 1:175414298-175414320 AAGGTGGAGGAGAAAAAAAATGG + Intronic
918037548 1:180889915-180889937 AGAGTGAGGGAGAAAAAAGAGGG - Exonic
918125033 1:181575844-181575866 ATAGAGAACCACAAAAAAGAAGG - Intronic
918127186 1:181595183-181595205 TAGGTGAAGCAGAAAAGAAAGGG + Intronic
918475273 1:184917850-184917872 ATGGTTAAGGGTAAAAAAGAGGG - Intronic
918572355 1:186012225-186012247 ACGTTGAAGCAAAAAAAAAAAGG - Intronic
918685130 1:187405252-187405274 CCAGTGAAGAAGAAAAAAGAAGG - Intergenic
918768732 1:188523869-188523891 AAGGTGTAGTAGAAAGAAGAAGG + Intergenic
918845750 1:189609180-189609202 ATTGTGAGGCAGAAAAAAAAAGG + Intergenic
918910858 1:190567028-190567050 ATGATGTGGCAGCAAAAAGAGGG - Intergenic
919094205 1:193010356-193010378 AAGGGGAAGAAGAAGAAAGAAGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919179065 1:194058444-194058466 TTGGTGAAGCAGGAGAGAGAGGG + Intergenic
920032334 1:203044913-203044935 AGGGAGAAGAAGAAAAGAGAAGG - Intronic
921031315 1:211337434-211337456 ATGGAGAGGCAGAGAAACGAAGG + Intronic
921203930 1:212831950-212831972 ATGGGGAAACAGAAAACAGCAGG - Intronic
921446935 1:215258080-215258102 AGGGTGAAGCATGAATAAGATGG + Intergenic
921667689 1:217892364-217892386 ATGTTGATTAAGAAAAAAGAAGG + Intergenic
922353177 1:224751936-224751958 CTGATGAACCAGAAGAAAGATGG + Intergenic
923051325 1:230393109-230393131 AAGGGGAAGGGGAAAAAAGAAGG + Intronic
923593595 1:235342308-235342330 ATGGTGCTGCAGAAAACAGGTGG + Exonic
923665267 1:235993410-235993432 GTGGGGAAGGAGAAAGAAGAGGG + Intronic
923961454 1:239088752-239088774 ATGGGAAAGTTGAAAAAAGAAGG - Intergenic
924221759 1:241884225-241884247 AAAGTGAGGGAGAAAAAAGAAGG - Intronic
924428549 1:243976545-243976567 AGGGTGAAGCACAAAGAACAGGG + Intergenic
924717259 1:246588298-246588320 ATGGGGAAGTACAAAAAAAAAGG + Intronic
1063246090 10:4220281-4220303 ATGCTGGGGCAGAAAAAGGAAGG - Intergenic
1063342195 10:5276816-5276838 ATGGTGAAGGAGAGAAATGAAGG + Intergenic
1063917197 10:10895459-10895481 AAGCAGAAGCAGAAAAAATATGG + Intergenic
1065432818 10:25676611-25676633 ATAGTGAGGCAGAAATAAAAGGG + Intergenic
1065804274 10:29380628-29380650 ATGGTGAAGCAGAAACCACTGGG + Intergenic
1065845967 10:29743644-29743666 ATGGAGAAGCAGATAAACTACGG - Intergenic
1065944908 10:30597392-30597414 ATGGTGAAGCAGAAACCACTGGG - Intergenic
1066020746 10:31298176-31298198 ATACTGATGCAGAAGAAAGAAGG + Intergenic
1066109023 10:32180019-32180041 AGGGTGTAGCAGTAAAAAGGAGG + Intergenic
1066511464 10:36102852-36102874 ATGTTGAAGAAGAACAAAGTTGG + Intergenic
1067277905 10:44850919-44850941 ATGGTGCAGCAGGACAGAGAGGG - Intergenic
1067723130 10:48744925-48744947 GTGCTGAAGCAGAAAAAGCAAGG - Intronic
1067821014 10:49530171-49530193 ATGGTGATGCAGGAAAACTAAGG + Intronic
1068284900 10:54921913-54921935 ATGGTGGAGCAGAAGAGAAAGGG + Intronic
1068522149 10:58088906-58088928 AAGGTAAAGCAGAAAAAAAAAGG + Intergenic
1068671841 10:59730940-59730962 TTCGTATAGCAGAAAAAAGATGG - Intronic
1069098234 10:64286572-64286594 TTGATGAAGCAGGAGAAAGAGGG - Intergenic
1069127089 10:64649377-64649399 AGGATGAAGTACAAAAAAGATGG - Intergenic
1069255630 10:66328853-66328875 GCAGTGAAGCAGGAAAAAGAGGG + Intronic
1070631249 10:78086321-78086343 AAGGGGAAACATAAAAAAGAAGG + Intergenic
1070706324 10:78641751-78641773 CTTGTGAAGCAGGAGAAAGATGG - Intergenic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1070997651 10:80800070-80800092 GTAGTGAAGCAGAAAATAAAGGG - Intergenic
1071096025 10:81975863-81975885 ATGAGGAAGAAGAAAACAGATGG + Intronic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072851369 10:98896476-98896498 ATGGTGATGAAGAAAAAACATGG + Intronic
1073093164 10:100961849-100961871 AAAGGGAAGGAGAAAAAAGAGGG - Intronic
1073415605 10:103379163-103379185 ATGGTGGATCAGAAACCAGAAGG - Intronic
1073679492 10:105687027-105687049 AAGCTGAAGCAGGAGAAAGAGGG + Intergenic
1073767823 10:106702720-106702742 TTAGGGAAGGAGAAAAAAGAAGG - Intronic
1074249873 10:111734282-111734304 ATGGCGTGGCAGAGAAAAGAAGG - Intergenic
1074428312 10:113371475-113371497 ATTGTGAAGAAGAAAGAATAGGG - Intergenic
1074685405 10:115958022-115958044 GTGCTGACTCAGAAAAAAGAAGG + Intergenic
1075185891 10:120256741-120256763 ATGGTAAAGCACAATACAGAAGG + Intergenic
1075259576 10:120950758-120950780 ATAGTGAAGAACAAAGAAGAGGG - Intergenic
1075292297 10:121240933-121240955 TTGGTGAAGGAGAAAAATGAAGG - Intergenic
1075468424 10:122669950-122669972 TTGGTGAGGCAGTAAATAGAAGG + Intergenic
1075481620 10:122787277-122787299 ATGTTGAAGCAACAGAAAGAAGG + Intergenic
1075725103 10:124606956-124606978 AGGATGAAGCAGAGAAAAGAGGG - Intronic
1076118755 10:127919691-127919713 AGGGCCAAGCAGACAAAAGATGG - Intronic
1076216695 10:128700293-128700315 ATCATAAAGAAGAAAAAAGATGG + Intergenic
1078500467 11:11869846-11869868 ATGGTGCAAGAGCAAAAAGAGGG - Intronic
1078712204 11:13804721-13804743 ATCTTGAAGGAGAAAAAAGTGGG + Intergenic
1079766335 11:24397794-24397816 ATGTTAAAGAAGAAGAAAGAGGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1080122446 11:28693236-28693258 GTGGTAAAGCAGGAGAAAGAAGG - Intergenic
1080259569 11:30332939-30332961 CTGGTAAAAGAGAAAAAAGAAGG + Exonic
1080733019 11:34980014-34980036 ATGGTGAAAGAAAAAAAAAAAGG - Intronic
1080782828 11:35447154-35447176 ATAGGAAAGCAGAAAAAAGCAGG - Intronic
1080884572 11:36354773-36354795 ATGATGGTGCAGAACAAAGAGGG + Intronic
1080956103 11:37097905-37097927 ATAATGAAGCAGGAAAAATAGGG + Intergenic
1081470700 11:43367564-43367586 ATAGTGAAGAATAAATAAGAGGG + Intronic
1081697887 11:45129830-45129852 ATGTTGAAGAAGAATAAAGTTGG + Intronic
1081847965 11:46254127-46254149 CTGGGGATCCAGAAAAAAGAAGG - Intergenic
1081923803 11:46805540-46805562 ATGGTGAAATGGAAAAAAGTGGG - Intronic
1083079752 11:60078428-60078450 AGGATGAGGCAGAAAAAAGTCGG - Intergenic
1083126255 11:60569004-60569026 ATGTTGAAGAAGAATAAAGTTGG + Intergenic
1083241409 11:61391579-61391601 AGGGTAAAGCAGGAAACAGATGG - Intergenic
1083556906 11:63636842-63636864 GTGGGGAAGGAGAAAAATGAAGG - Intronic
1084363088 11:68681785-68681807 AAGGAGAAGAAGAAAAGAGAAGG - Intergenic
1084373959 11:68763646-68763668 TGGGTGAAGCAGAAGAAAGCGGG + Intronic
1085600099 11:77847946-77847968 ATGGTGAGGCAGAAAAAAAGAGG + Intronic
1085639748 11:78185947-78185969 ATGATGAGGCAGGAAAAACAAGG - Intronic
1085858348 11:80202171-80202193 ATTGTGAAGAAGAAATATGAAGG + Intergenic
1085967181 11:81541347-81541369 ATGGTTAAGTGGAAAAAACAAGG - Intergenic
1086005607 11:82031786-82031808 ATGGTTAGGCAGAATACAGAAGG - Intergenic
1086291586 11:85316543-85316565 ATGATGCAGCAGAATAAAGAAGG + Intronic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1087152859 11:94874062-94874084 AGGGTGAAGCAGAACAATGCTGG - Exonic
1087261697 11:96019208-96019230 ATTATAAAGCAGAAAAAATAAGG - Intronic
1087397533 11:97620297-97620319 ATTGTGAAGTAAAAAAAAAAAGG - Intergenic
1087750211 11:101998919-101998941 ATGGTGTGGCAGAAAGAACATGG - Exonic
1087847540 11:102990410-102990432 ATGCTGAAGCAGAGAAATGCTGG - Intergenic
1088767187 11:112994070-112994092 ATGGCAAAGCAGAAAGAAAAAGG - Intronic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1089590903 11:119540232-119540254 ATAATGAAACAGAAGAAAGATGG + Intergenic
1089722080 11:120435181-120435203 ATGGCCAAGGAAAAAAAAGAAGG - Intronic
1090767551 11:129889736-129889758 ATGAGGAAAGAGAAAAAAGACGG + Intronic
1091393834 12:141714-141736 AATGTGAGACAGAAAAAAGAAGG + Intronic
1092286449 12:7131500-7131522 AGGTGGAGGCAGAAAAAAGAGGG + Intronic
1092631171 12:10379765-10379787 ATGAAGCAGCAGAAAAAAAATGG + Exonic
1092836743 12:12497294-12497316 ATGATGTTGCAGAAAAAACAGGG + Intronic
1093000495 12:13990628-13990650 GTGCTGAAGCAGAAAAATGCAGG - Intergenic
1093367371 12:18320526-18320548 GTGGTGAAGCTGAAAAATGAAGG + Intronic
1093543690 12:20319738-20319760 AAGGTGAAGGACAAAAAAGAAGG + Intergenic
1093550274 12:20401631-20401653 ATCGTGAAGCAGGTAGAAGATGG - Intronic
1093772550 12:23034461-23034483 AAAGGGAAGAAGAAAAAAGAGGG - Intergenic
1094138188 12:27151595-27151617 ATGGTGAAGCAGAGTTAATAGGG + Intergenic
1094474964 12:30833765-30833787 GTGGAGAAGGAGAGAAAAGAAGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095566576 12:43631361-43631383 AGGGAGTAGCAGAAAAGAGAAGG - Intergenic
1095882118 12:47148937-47148959 ATGGGGAAGGAGAAAAAAACGGG - Intronic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1096924162 12:55123860-55123882 ATTGTAAAGCAGGAAAGAGATGG - Intergenic
1097613424 12:61854562-61854584 AGAGTCAAGCAGAAAAGAGAGGG + Intronic
1098394115 12:70000435-70000457 ATCATGAAGAAGGAAAAAGAAGG - Intergenic
1098482639 12:70983848-70983870 ATGGTGAATCAGTAAAGAAAGGG + Intergenic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1098868677 12:75790802-75790824 AAGGTAAAGCAGAAAGAACATGG + Intergenic
1099171666 12:79371920-79371942 AAGGTAAAGAAGAACAAAGATGG - Intronic
1099639206 12:85263021-85263043 ATGGGGAAGTGGCAAAAAGAAGG + Intronic
1099767668 12:87009420-87009442 TTGGAGGAGGAGAAAAAAGATGG + Intergenic
1099826743 12:87785329-87785351 ACTGTGAAGCACAAAGAAGAGGG - Intergenic
1100060236 12:90566254-90566276 CTAGTGAAGCAGTAAGAAGAGGG - Intergenic
1100249080 12:92796672-92796694 ATGGTGAAGTAGGGAAAACAAGG - Intronic
1100656301 12:96649443-96649465 CTGGTGTGGCATAAAAAAGAAGG - Intronic
1100693818 12:97068192-97068214 ATGATGATGGGGAAAAAAGAGGG - Intergenic
1102133957 12:110557030-110557052 AGGGAGAAGCTGAAAAATGAAGG + Intronic
1102342034 12:112129163-112129185 ATGCTGAACCAGAAAAAGGGTGG + Intronic
1102593833 12:113977395-113977417 ATTGTGAAAATGAAAAAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1105423334 13:20272389-20272411 ATGGTCCAGCAGAAAACAGGTGG + Intergenic
1105723171 13:23135712-23135734 ATGCTGCAGCAGAATAAACAAGG + Intergenic
1106095844 13:26642409-26642431 ATTGGTAATCAGAAAAAAGATGG - Intronic
1106505014 13:30363677-30363699 ATGGTGTAGGAGAAAAAGGATGG - Intergenic
1106809453 13:33345841-33345863 TTGTTCAAGCAGAAAAAAAAAGG + Intronic
1106827178 13:33536178-33536200 ATGGTGAAGCAAAACAGAAATGG + Intergenic
1107167711 13:37301830-37301852 ACAGAGAAGGAGAAAAAAGATGG - Intergenic
1107168377 13:37310664-37310686 ATGGTGAAGCAAAGTACAGAAGG + Intergenic
1107568422 13:41630425-41630447 GTGTTCAAGCAGAAAGAAGAAGG - Intronic
1107683695 13:42875823-42875845 AAGGTGAAGCAGGGAAAGGAAGG + Intergenic
1107905372 13:45056636-45056658 AGGGAGAAACAGAAAAAAGGAGG - Intergenic
1108161393 13:47644113-47644135 ATTCTGAAGCAGAAAAATCAAGG - Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108277671 13:48827456-48827478 ATGGTGGAGCAGGAGAGAGAGGG + Intergenic
1108701068 13:52944611-52944633 ATGGTTAAGCACAGGAAAGAAGG + Intergenic
1109050769 13:57478484-57478506 CTGGTCAAGAAGAAAAAAGCTGG + Intergenic
1109138403 13:58682421-58682443 AAGCTCAAGCAGAAAAAAGCAGG - Intergenic
1109280479 13:60349860-60349882 AGGGTGAAGGACAAAACAGAAGG - Intergenic
1110037248 13:70703734-70703756 ATGGTTAAGGAGATAAAGGAAGG + Intergenic
1110351867 13:74518187-74518209 ATGGTGATGAAGAAAGAAGGAGG - Intergenic
1110481031 13:75976445-75976467 ATGATGAGGTAGAAAATAGAAGG + Intergenic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1110690029 13:78422169-78422191 ATGGTGGAGGGAAAAAAAGAAGG + Intergenic
1110861845 13:80353105-80353127 ATGGTGAAACACAAAATAAAAGG - Intergenic
1110930134 13:81205272-81205294 ATGGTCAAGGAGAAAAATGATGG + Intergenic
1111317208 13:86578204-86578226 GTGGAGAAACAGAAAAAAAAAGG - Intergenic
1111727320 13:92029188-92029210 TTTGTGAGGAAGAAAAAAGAAGG + Intronic
1112748342 13:102553073-102553095 ATGGTCCAGCAGAGAGAAGACGG - Intergenic
1112982914 13:105408895-105408917 ATGGATCAGAAGAAAAAAGAGGG + Intergenic
1113269583 13:108658404-108658426 AAGTTGAAACAAAAAAAAGAAGG - Intronic
1114126749 14:19736618-19736640 ATGATCAAACAGACAAAAGATGG - Intronic
1114918740 14:27299049-27299071 CTTGTGAGGCAGAAAAAACAAGG - Intergenic
1114921760 14:27341428-27341450 AATGTAAAGCAGAAAAAAGAGGG - Intergenic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1115716887 14:36115535-36115557 TGGGTTAAGCAGAAAAGAGACGG - Intergenic
1115927443 14:38451019-38451041 ATTGGAAAGCAGAAAAAAGCAGG + Intergenic
1116369120 14:44107714-44107736 ATGTTGAATCAAAAAAAAGGGGG + Intergenic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1117797243 14:59407023-59407045 ATGGTGATGAATAAAAAGGAAGG + Intergenic
1118199265 14:63657178-63657200 ATGGTGAAGCCACTAAAAGAGGG - Intergenic
1118604843 14:67495268-67495290 ATGGAGAAGCAAGAAAAAGGAGG - Intronic
1118837410 14:69486588-69486610 CTGCTGAGGCAGAAGAAAGATGG - Intronic
1119161345 14:72454966-72454988 TTGCAGAAGCAGAAAACAGAGGG - Intronic
1119858189 14:77916715-77916737 ATAGTGAGGAAGAAAGAAGAGGG - Intronic
1120383852 14:83819086-83819108 GTGGGGAAATAGAAAAAAGAGGG - Intergenic
1120537328 14:85713110-85713132 ATACTGAAGCAGATAAAACAAGG - Intergenic
1120774447 14:88418135-88418157 ATGATGAAGAAGAAGAATGAAGG - Intronic
1120926151 14:89799543-89799565 ATGCTGTAACAGAAACAAGAGGG - Intronic
1121600150 14:95197339-95197361 AAAGTAAAGAAGAAAAAAGAAGG + Intronic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122765654 14:104067806-104067828 ATGGTGGAGCAGAAGAGAGAGGG + Intergenic
1124848812 15:33316117-33316139 ATGGTGAAAAAGAAAAGAGTGGG + Intronic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1125052581 15:35317982-35318004 ATTGTAAAGAAGAAAAAAAAAGG + Intronic
1125152370 15:36547252-36547274 AGAGAGGAGCAGAAAAAAGAAGG + Intergenic
1125496278 15:40197457-40197479 AAGGTGAAGGAGAATAAAGAAGG + Intronic
1126428413 15:48554560-48554582 GTGGAGAAGCAGGAAAGAGATGG + Intronic
1126529893 15:49700906-49700928 AGGGTGAAGAACAGAAAAGATGG + Intergenic
1126771142 15:52057195-52057217 ATACTGAAGCAGGAAAGAGAAGG - Intronic
1126940940 15:53764787-53764809 ATGGAGAGGCATAAAAAATAGGG - Intergenic
1127596078 15:60483380-60483402 ATGGTGAAGCGGACTAGAGATGG + Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128680390 15:69647285-69647307 AGGCTGAAGCAGGAAAATGAGGG + Intergenic
1128811482 15:70576119-70576141 ATGGGGAAGCAGGAAAGAGTTGG + Intergenic
1128972322 15:72118285-72118307 AAGGTGAAGAAGAAAAAATTTGG - Exonic
1129972477 15:79790955-79790977 GGGGTGAAGCAGAGAAGAGATGG - Intergenic
1130185730 15:81679541-81679563 ATGGAGAAACAGAAAAAAGCAGG + Intergenic
1130387193 15:83422298-83422320 ATCATAAGGCAGAAAAAAGAAGG - Intergenic
1131139816 15:89968077-89968099 ATGATGATGAAGAAAGAAGAGGG + Intergenic
1133724641 16:8526148-8526170 AAAGTGAAGGAGAAACAAGACGG - Intergenic
1134348983 16:13418677-13418699 ATGGCAAAGCAGCAAAGAGATGG + Intergenic
1135610250 16:23860047-23860069 TTTGTGAAGCAGAAAAAAAGAGG + Intronic
1137756887 16:50909405-50909427 ATGAGGAAGCAGAGAAGAGAAGG - Intergenic
1137804307 16:51288899-51288921 ATGACGAAGGAGCAAAAAGAAGG - Intergenic
1137909876 16:52366735-52366757 ATGGAGAAGAATAAAAAAGCTGG + Intergenic
1137954412 16:52814538-52814560 ATGGTGAAGCCTTCAAAAGATGG - Intergenic
1138773026 16:59687513-59687535 ATGGTGGAGCAGGAGGAAGAGGG + Intergenic
1139128460 16:64110894-64110916 ATGGTGAATCAGAAGAAAGCTGG - Intergenic
1139346278 16:66305922-66305944 ATGGTGGAGCAGGAGAGAGAGGG - Intergenic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1139813826 16:69649406-69649428 AAGTAGAAGCAGAAAAATGAAGG - Intronic
1143818378 17:9539246-9539268 ATGAGGAAGAAGAGAAAAGAGGG + Intronic
1144098873 17:11926237-11926259 AAGTTGAAGAAAAAAAAAGAAGG - Intronic
1144272741 17:13633995-13634017 AAGGTGAAGAATAAAAATGAAGG + Intergenic
1144552413 17:16252915-16252937 ATGGTGAAATAAAACAAAGAAGG + Intronic
1145076588 17:19860188-19860210 ATGGTAAATTAGAAAAGAGATGG - Intronic
1145764454 17:27448743-27448765 ATGATGATGCAGAGAAAAGCAGG + Intergenic
1146379242 17:32316381-32316403 ATGGTCAAGAAAAAAAAAGTGGG + Intronic
1147872728 17:43598901-43598923 ATAGTAGAGCAAAAAAAAGATGG - Intergenic
1148546119 17:48520338-48520360 AAGGAAAAGGAGAAAAAAGAGGG - Intergenic
1148702241 17:49595649-49595671 AAACTGAAGGAGAAAAAAGAAGG - Intergenic
1148945189 17:51256096-51256118 ATAGTGAAAAAGGAAAAAGAAGG + Intronic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149269884 17:54966848-54966870 ATGATGAAGCAGAAGACAAAAGG - Intronic
1149425772 17:56552900-56552922 ATGGTGAGGTAGACAAAAGGTGG - Intergenic
1149914082 17:60592428-60592450 AAGTTGAAAAAGAAAAAAGAAGG + Intergenic
1151585599 17:75006606-75006628 ATGATGAAGCTGAAACCAGAAGG + Intergenic
1152327447 17:79649873-79649895 ATGGTGGAGCAGGAACAAGCAGG + Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1156177341 18:34562505-34562527 ATGGTAAAGAAAAAAAAGGAAGG - Intronic
1156302573 18:35848307-35848329 ATGGTGGTGCAGAATATAGAAGG - Intergenic
1156315458 18:35965129-35965151 AAGGAGAAGGAGAAAAAAGAAGG - Intergenic
1156406318 18:36786080-36786102 AAGGTGAAGCAGAGACAGGAAGG + Intronic
1157303664 18:46500082-46500104 AGGGGGAAGAAGAAAAGAGAAGG - Intronic
1157833937 18:50881721-50881743 ATGTTGATGCAGAAACAAGCAGG + Intronic
1158280413 18:55819393-55819415 ATGGAGAAGGAGACCAAAGAGGG + Intergenic
1158328932 18:56340191-56340213 GTGGTTAAACAGAAAAAAGGTGG + Intergenic
1158682905 18:59584671-59584693 ATGGTGAAGCACAAGCAAGAGGG - Intronic
1158720443 18:59919817-59919839 GTGGTGAAGAAGAATAAAGCAGG - Intergenic
1158871289 18:61690861-61690883 ATGGTGATACAGAAAAGTGAGGG + Intergenic
1159482073 18:69002297-69002319 TTGTAGAGGCAGAAAAAAGAGGG + Intronic
1159512939 18:69419694-69419716 AGGATGAAGAAGTAAAAAGATGG + Intronic
1159949586 18:74473101-74473123 AGAATGAAGCAGAAAAAAGGAGG - Intergenic
1159999874 18:75007294-75007316 AATGTGCAGAAGAAAAAAGATGG - Intronic
1160064552 18:75562561-75562583 ATTGAGAGGCAGAGAAAAGAAGG + Intergenic
1160667888 19:341710-341732 AAGTGGAAGCAGGAAAAAGAGGG + Intronic
1161674991 19:5641169-5641191 ATGCTTAAAAAGAAAAAAGAAGG - Intronic
1161993705 19:7699516-7699538 GTGTTGAATCAGAAAAAGGAGGG + Intronic
1163325208 19:16599150-16599172 AGAGTGAAGTAGAAAAAAAATGG - Intronic
1164121341 19:22268281-22268303 AATGGGAAGCAGAAAAAAGCAGG + Intergenic
1165194466 19:34090829-34090851 ATGGTGCAGGAAAGAAAAGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166228700 19:41413066-41413088 ACAGTGAAGCAGAGAAAGGATGG - Intronic
1166372181 19:42308063-42308085 ATGGGGAAACAGTTAAAAGATGG - Intronic
1166388432 19:42395467-42395489 ATGGTGACACAGAAAAACGATGG + Intergenic
925796987 2:7556256-7556278 ATGGTGAAAAAGAAAAGGGAGGG + Intergenic
925882367 2:8363505-8363527 ATGGAGAAGAGGAAAACAGAAGG + Intergenic
925886643 2:8399390-8399412 ATGCTTAATCAGAATAAAGATGG - Intergenic
926537156 2:14127560-14127582 ATGGTGAAGCAGGAGAGAGACGG + Intergenic
926772151 2:16387885-16387907 ATGGTGAAGATGAAATGAGAAGG - Intergenic
926783976 2:16502031-16502053 ATGGTGAAGGAAAAAACACAGGG + Intergenic
926829035 2:16940169-16940191 ATGGTGGAGCTGAAGAAAGAGGG - Intergenic
927013585 2:18932153-18932175 ATTGAAAAGCAGAGAAAAGAAGG - Intergenic
927149752 2:20188833-20188855 AAGGCGGAGCGGAAAAAAGAGGG - Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927331673 2:21871870-21871892 ATGGTGAAGGAGCAAGAACATGG + Intergenic
927742028 2:25579695-25579717 ATGGTGAAGGAAAAAAAATGAGG + Intronic
927920249 2:26966811-26966833 AAGGTGAAGCAGATAAAGAAGGG + Intergenic
927929823 2:27036924-27036946 ATGGTGAGGAAGGAAGAAGAGGG + Intronic
928982332 2:37149024-37149046 CTGGTAAAAGAGAAAAAAGAAGG + Intronic
929014934 2:37484751-37484773 ATGGGGGATCAGAAAACAGAGGG - Intergenic
929059087 2:37905011-37905033 ATGGAGTAGAAGAAAAAAGTAGG - Intergenic
929301025 2:40303838-40303860 AACGTGAAGCAGGAAAAGGAAGG + Intronic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
929632326 2:43476388-43476410 ATGGCACAGCAGAAACAAGAAGG + Intronic
929993708 2:46811869-46811891 AAGGAGAAGGAGACAAAAGAAGG - Intergenic
930282269 2:49384437-49384459 ATGGTAGAACAGATAAAAGAAGG + Intergenic
930474176 2:51858705-51858727 AATTTGAAGCAGAAAAAAGAAGG + Intergenic
931483678 2:62669056-62669078 AGGCAGAAGCAGAAGAAAGACGG - Intergenic
932143888 2:69302263-69302285 ATGGCAAAGCAGAATACAGAAGG + Intergenic
932803101 2:74760137-74760159 TTGGTGACTCAGAAAAGAGAGGG - Intergenic
933035698 2:77394773-77394795 AAGGTGAAGCAGGAACACGAAGG + Intronic
933140782 2:78791058-78791080 GAGGTGAAGCAGAAACAATATGG + Intergenic
933233056 2:79831034-79831056 ATTGAGAAGAGGAAAAAAGAGGG - Intronic
933406108 2:81861898-81861920 ATGTTGAATGAGAAAAGAGAAGG + Intergenic
933459147 2:82557574-82557596 ATGTTCAACAAGAAAAAAGATGG + Intergenic
933482804 2:82878003-82878025 ATTGGAAAGCAGAAAAGAGATGG + Intergenic
933513874 2:83276536-83276558 AAGGTGAAGGAGAAGCAAGAAGG + Intergenic
934974183 2:98788905-98788927 ATTGAGAAGAAGAAAAAACAGGG - Intergenic
935274253 2:101462704-101462726 ATGATGAAGTGGAAACAAGATGG + Intronic
935344470 2:102093200-102093222 TTGGTGAAGGAGAAAAAAAAGGG + Intronic
935433649 2:103004548-103004570 AGGGTGAGGCAGAAATAAGGTGG + Intergenic
935455517 2:103263076-103263098 ATGGTGAAGGAATATAAAGAAGG + Intergenic
935629618 2:105202378-105202400 ATGGTGAAGCAGGAGAGAGAGGG + Intergenic
936167817 2:110139142-110139164 AAAGTAAAGGAGAAAAAAGATGG + Intronic
936738055 2:115470371-115470393 AGGATGAAACTGAAAAAAGATGG - Intronic
936765663 2:115845547-115845569 ATGGGGAAGAGGAAAATAGAAGG - Intronic
936856954 2:116969919-116969941 ATGGTAAAGCAGTGAAGAGATGG + Intergenic
936932412 2:117803856-117803878 ATGGAGATGCAGAAATCAGATGG - Intergenic
937169583 2:119852196-119852218 AAGGAGAAGCGGAAAAAAGAAGG - Intronic
939044464 2:137233836-137233858 CTGGTAAAGAAGAAAACAGAAGG + Intronic
939047837 2:137270329-137270351 AGGTTGAAGAAGAACAAAGAGGG + Intronic
939123919 2:138152304-138152326 AGGGGGAAGAAGAAAGAAGAAGG - Intergenic
939465727 2:142553375-142553397 ATATTGAAGCAGAAAGAATATGG + Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939596925 2:144136683-144136705 ATGGAGAGGCAGAGAAAAAAGGG - Intronic
939751723 2:146055923-146055945 ATGATAAAGCAAGAAAAAGAAGG + Intergenic
940074501 2:149726065-149726087 ATGGTGTAGCAGAAAAAGAAGGG + Intergenic
940182791 2:150954258-150954280 ATAGTGAAGGAGCAAAGAGAGGG - Intergenic
940361060 2:152796177-152796199 ATGATGAAGCAGAGAAGACAAGG + Intergenic
940578274 2:155542831-155542853 ATGGTGTAGCAACAATAAGATGG - Intergenic
940629685 2:156221995-156222017 AATGGGAAGCAGAAAAAAGCAGG + Intergenic
940764891 2:157779881-157779903 ATGAGGAAGGAGATAAAAGAAGG - Intronic
940848748 2:158668344-158668366 ATGATGAATGTGAAAAAAGAGGG - Intronic
941485584 2:166076587-166076609 ATGTTGAAGAAGAACAAAGTTGG + Intronic
941558478 2:167014113-167014135 ATGGTAAACCAATAAAAAGAGGG - Intronic
941617810 2:167741182-167741204 ATGGTGAGGCAAAAAAAAGTGGG + Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942427106 2:175871726-175871748 ATGGTTAAGGAGAAATTAGATGG + Intergenic
942493467 2:176513182-176513204 ATGGTGTAAAAGAAAAAAGATGG + Intergenic
942523214 2:176826252-176826274 ATTGTGTAGCAAAAAAAAAATGG + Intergenic
942677464 2:178443497-178443519 ATTCTGCAACAGAAAAAAGAGGG + Intronic
942742125 2:179193146-179193168 ATGTTGAGGAAAAAAAAAGATGG + Intronic
943168824 2:184369383-184369405 AGGATGAAGCACAGAAAAGAAGG - Intergenic
943798645 2:192030106-192030128 ATGTTGAAGAAGGAAAAATAAGG + Intronic
943859718 2:192845852-192845874 AAGTTGAAGAAAAAAAAAGACGG - Intergenic
944031234 2:195237199-195237221 ATAGAGAAGCACAAATAAGAGGG - Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944412100 2:199456120-199456142 AGGGGGAGGGAGAAAAAAGAGGG + Intronic
944719977 2:202414013-202414035 ATAGTGAAGCACAATAAACAAGG - Intronic
945164544 2:206928700-206928722 AATGGAAAGCAGAAAAAAGAAGG + Intergenic
946076477 2:217077743-217077765 ATGAAAAAGCAGAACAAAGAGGG - Intergenic
946149709 2:217756066-217756088 ATGCAGAGGCAGAAAAATGAGGG - Exonic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
947598734 2:231431305-231431327 ATGGTGAAGAGGAAAATAGCAGG + Intergenic
947944923 2:234093191-234093213 ATGCTGAGGCAGAGGAAAGAAGG + Intergenic
948127211 2:235572968-235572990 AAGAAGAAGAAGAAAAAAGATGG - Intronic
948310805 2:236984950-236984972 ATGGGGATGGAGTAAAAAGATGG + Intergenic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1169525958 20:6426107-6426129 ATGGCGGTGGAGAAAAAAGAGGG - Intergenic
1169555787 20:6748338-6748360 ATGCAGAAGCAGACAAAAGATGG + Intergenic
1169718636 20:8647874-8647896 TTGGAGAAGCAGAAAAACAAGGG - Intronic
1169761004 20:9093934-9093956 ACTGTGAAACAGACAAAAGATGG - Intronic
1169940833 20:10935271-10935293 GAGGAGAAGCAGAAAAAAGCTGG - Intergenic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170271813 20:14535635-14535657 ATAGTGAAGAAGAAGAAACAGGG + Intronic
1170306344 20:14942379-14942401 AAGGAGAAGGAGAAAAAAAAAGG - Intronic
1170527127 20:17250056-17250078 TTGGGGAAGCTGAATAAAGAAGG - Intronic
1170984004 20:21241856-21241878 AAGCTGAAGCAGAAAAAAAAAGG - Intronic
1171332696 20:24355693-24355715 GGGGGGAAGGAGAAAAAAGAGGG - Intergenic
1171822667 20:29868392-29868414 ATGGAGAATCAGGAGAAAGAAGG + Intergenic
1171942066 20:31340389-31340411 ATTTTAAAGAAGAAAAAAGATGG - Intergenic
1171944128 20:31361011-31361033 AGAGTGAAGCAGAAAAAACCGGG + Intergenic
1171986463 20:31664813-31664835 AGGGTGGAGCAGAAGAGAGAGGG + Exonic
1172065795 20:32219390-32219412 ATGGTGAAGGAGCAGAAAGAAGG + Intronic
1172601190 20:36184277-36184299 ATGGTGAAACATAACAAAAATGG + Intronic
1173401695 20:42731609-42731631 ATGGTACAGCAGAAAAACTATGG + Intronic
1173986060 20:47262420-47262442 CTGGTGAAGCTGAAAAAGTATGG + Exonic
1173997503 20:47350056-47350078 ATGCTGGAGCAGAAGAGAGAGGG + Intronic
1174541512 20:51293319-51293341 AAGGTGGAGAAGAGAAAAGAAGG - Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175506065 20:59485189-59485211 ATGGTGAAGCTCAGAAATGATGG - Intergenic
1176729278 21:10475284-10475306 ATGATGAAGTAGTAACAAGAGGG - Intergenic
1177731781 21:25036510-25036532 ATGGTTTAGCAGAAATAATATGG - Intergenic
1178512878 21:33220875-33220897 ATGCTGAAGTAGAATAAAGCTGG - Intergenic
1179355307 21:40653296-40653318 TTGGAGCAGTAGAAAAAAGATGG + Intronic
1179375665 21:40848073-40848095 ATGGTGAGGCAGAAACAAAATGG + Intergenic
1179989183 21:44937814-44937836 ATGGTGGAACAGCAAAGAGAGGG + Intronic
1181663134 22:24368494-24368516 GGGGGGAAGCAGACAAAAGATGG - Intronic
1181983934 22:26786088-26786110 GTGGTGAGGCAGAAAAAAAGGGG - Intergenic
1182193234 22:28486275-28486297 AAAGTAAAGCAGAAAAGAGAAGG + Intronic
1182383045 22:29909590-29909612 ATGGTGAAGCACTTAAAAGAGGG + Intronic
1182710066 22:32316363-32316385 ATATTGAATGAGAAAAAAGAAGG + Intergenic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1182975285 22:34618350-34618372 GGAGAGAAGCAGAAAAAAGATGG - Intergenic
1183791156 22:40071122-40071144 ATCCTGTAGCAGAAAAAAAAAGG - Intronic
1184397632 22:44253259-44253281 ATACTGAATGAGAAAAAAGAAGG + Intronic
1184931468 22:47684277-47684299 TTTGAGAAGCAGAAAAAATAAGG - Intergenic
949109305 3:239408-239430 ATGCTGCAGCAGAGAAAAAAGGG - Intronic
949411802 3:3773634-3773656 AAGGAGAAGCACAAAAAACAGGG - Intronic
950855106 3:16097360-16097382 ATGGTGGAAAAGTAAAAAGAGGG - Intergenic
951150727 3:19287098-19287120 ATGGTAATGCAAAAAAAAAAAGG + Intronic
951432632 3:22626332-22626354 AACGGGAAGCAGACAAAAGAAGG - Intergenic
951742732 3:25942050-25942072 AGAGAAAAGCAGAAAAAAGAAGG - Intergenic
952224174 3:31357227-31357249 ATGGTGATGAAGACACAAGAGGG + Intergenic
952694454 3:36249491-36249513 AAGGTTAAGCAGTAAACAGAAGG + Intergenic
953367170 3:42354753-42354775 AGGGTGAAGAAGAAGAAAGGAGG - Intergenic
953552388 3:43913606-43913628 ATGGTGAAGGAGAAACACAAAGG - Intergenic
954006644 3:47596596-47596618 AAGAAGAAGAAGAAAAAAGATGG + Intronic
954517586 3:51192509-51192531 GTGGTGAAGAATAAAAAAGTAGG + Intronic
954955177 3:54512515-54512537 AAGGTGCAGGAGAAAAAGGAAGG - Intronic
955307436 3:57848424-57848446 AGGACGAAGAAGAAAAAAGAAGG - Intronic
955571748 3:60314674-60314696 ATGGTGTGGCAGAATAAAAATGG + Intronic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
956343450 3:68251554-68251576 AAAGTGAAGGAGAAAGAAGAGGG + Intronic
956374992 3:68604469-68604491 AAGGGAAAGCAGAAAAAAGCAGG + Intergenic
956420745 3:69084510-69084532 ATGGTGAAACAGAGAAAACATGG + Intergenic
957014763 3:75050040-75050062 ATTGTGAAGAAATAAAAAGAAGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
959024375 3:101223781-101223803 ATGCAGAAGAAGAAAACAGAAGG + Exonic
959204898 3:103294139-103294161 ATGGTGAAGAAGAGAAAGAAAGG + Intergenic
959256868 3:104026343-104026365 ATCTTGAAACAGAAAATAGAAGG - Intergenic
959694720 3:109236649-109236671 AATGTAAAGCAGAAAAAAGCAGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960299031 3:115979171-115979193 ATGGGGAAGAAGAGCAAAGAGGG + Intronic
960524197 3:118691132-118691154 AAGCTGAAGCACAAAAAAGGTGG - Intergenic
960547128 3:118928360-118928382 ATGGAGAAGGAGAGAAGAGATGG + Intronic
960849286 3:122035628-122035650 ATAGTGGAGCAGGAAAGAGAGGG - Intergenic
961091405 3:124115650-124115672 AGGGTGAAGCTGAAAAAGAAGGG - Intronic
961237340 3:125378531-125378553 CTGGTGAAGCAGGAAAGAGATGG - Intergenic
961806985 3:129496546-129496568 ATAGAAAAGCAGAAAAAAGTGGG - Intronic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
962384299 3:134920638-134920660 ATGGAGGAGCTGTAAAAAGAGGG + Intronic
962423802 3:135251172-135251194 CTGGTGATGCCAAAAAAAGATGG + Intronic
962499711 3:135978552-135978574 AATGTGAAGAAGAAAAAATATGG + Intronic
962956040 3:140267759-140267781 ATGTTGAGGTAGCAAAAAGATGG - Intronic
963347524 3:144113064-144113086 GTGGAGAAGTAGAAAAAAGTGGG - Intergenic
963569172 3:146970583-146970605 ATGGTAAAAGAGAAAAGAGAGGG + Intergenic
963656360 3:148056439-148056461 ATGGTGAAGAGGAAATAATAAGG - Intergenic
963676855 3:148322883-148322905 ATGATGAAGAAGGAGAAAGAAGG + Intergenic
963982360 3:151552861-151552883 ATGGTTTAACAGTAAAAAGAAGG - Intergenic
965424834 3:168509166-168509188 AGGGTGAAGGAGAAAAAAGTTGG + Intergenic
965935204 3:174100808-174100830 CTGGTGAACTAGAAAAAAAATGG - Intronic
966685416 3:182688478-182688500 AGGAAGAAGTAGAAAAAAGAAGG + Intergenic
968128035 3:196174702-196174724 TTTATGAAGCAGAAAAATGAGGG + Intergenic
968323870 3:197795145-197795167 TTGGGCAAGCAGAAACAAGAAGG + Intronic
969200965 4:5605620-5605642 ATGTTGAAGCAAGAGAAAGAAGG + Intronic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970572768 4:17398962-17398984 ATGGTGAGGGAGGAGAAAGAAGG - Intergenic
970765300 4:19541144-19541166 ATGGTAAAGCAGAATTCAGAAGG - Intergenic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
970973495 4:22014387-22014409 ATGATGAAGCAGAAAATAATGGG - Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971271428 4:25150683-25150705 ATGGTAAAAAAGCAAAAAGAAGG + Intronic
971447950 4:26772454-26772476 AAGTTGAAGGAAAAAAAAGATGG - Intergenic
971503400 4:27340953-27340975 GTGGTGATGAAGAAAAATGAAGG + Intergenic
971708336 4:30077839-30077861 ATTGGAAAGCAGAAAAAAGTTGG - Intergenic
971945889 4:33276777-33276799 CTGGTGATGCAGAATAAAGCAGG + Intergenic
972027097 4:34395295-34395317 ATGGTTAAGCATAAACAAAATGG + Intergenic
972044139 4:34641911-34641933 ATAGTGAAAAAGAACAAAGAAGG + Intergenic
972414239 4:38823215-38823237 ATGGTAAAGAAGATAAAAAATGG - Intronic
972769363 4:42182646-42182668 ATTCTAAAGCAGAAATAAGAAGG + Intergenic
972878743 4:43397133-43397155 ATGGTGTAAAAGATAAAAGATGG - Intergenic
973001084 4:44951584-44951606 GTGGTGGAGTAGAAAAAAGAAGG - Intergenic
973113046 4:46419111-46419133 ATGGTGGAGCAGGAAAGAGAGGG + Intronic
973180112 4:47256671-47256693 ATGGTGGAGCAGGAGAGAGAGGG + Intronic
973219737 4:47711547-47711569 TTGGTGAAGCAAGAAATAGATGG + Intronic
974162836 4:58162215-58162237 AAGGTGAAGGGAAAAAAAGAAGG - Intergenic
974482013 4:62457241-62457263 ATGGTGAGGAAGATGAAAGAAGG + Intergenic
974635574 4:64560314-64560336 ATTTTGAAGAAGAAAAAAGTTGG - Intergenic
974696703 4:65384785-65384807 ATGCTGGAACAGAAATAAGATGG - Intronic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975366335 4:73533281-73533303 ATGGTTTAGAAGAAAGAAGAGGG - Intergenic
976210352 4:82662555-82662577 ATGGTTAAAAAAAAAAAAGATGG + Intronic
976536800 4:86227085-86227107 TTGATGAATCAGAAATAAGAAGG + Intronic
976548659 4:86367870-86367892 ATCTTGAAGCAGAACCAAGATGG - Intronic
976775315 4:88699455-88699477 ATGGTGAGCCAGTAAGAAGATGG - Intronic
977140891 4:93370615-93370637 ACCTTAAAGCAGAAAAAAGAGGG - Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977984458 4:103365685-103365707 ATGGTGTAGCACAAATAAGAAGG + Intergenic
977989454 4:103423190-103423212 ATGGTGGAGCAGACATAACAAGG - Intergenic
978976196 4:114877186-114877208 AAAATGAAGCAGAAAATAGACGG - Intronic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
980318347 4:131235403-131235425 ATGGTGAACCAAAAAGATGATGG + Intergenic
981072450 4:140558162-140558184 AAGGTGAAGCAGTAACACGAAGG - Intergenic
981236692 4:142424794-142424816 ATGGTGAAACAGGAAAAAGAGGG + Intronic
981423881 4:144581606-144581628 ATGGTGATTCAGAAAACTGAAGG - Intergenic
981520998 4:145662218-145662240 AGGCTGAAGGAGGAAAAAGAGGG - Intergenic
982148910 4:152429930-152429952 TTGGTGTTGTAGAAAAAAGAAGG + Intronic
982293727 4:153805880-153805902 AAATTGAAGGAGAAAAAAGATGG + Intergenic
983249327 4:165327158-165327180 ATGGTAGACCAGAAAAAGGAAGG + Intergenic
983922555 4:173361896-173361918 AGAGTGAGGCATAAAAAAGATGG - Intergenic
984056987 4:174942253-174942275 CTAGTGAAGCAGTAAGAAGAGGG - Intronic
984128503 4:175842753-175842775 ATCATAGAGCAGAAAAAAGATGG - Intronic
984695333 4:182773719-182773741 AAGGTGAACCAGAAAAGGGAAGG + Intronic
985303637 4:188515341-188515363 CTGGTGAAGGAAAAAAAAAATGG - Intergenic
985562785 5:599809-599831 CTGGTGAAGCTGAAGAAAAAAGG - Intergenic
985987592 5:3529689-3529711 AGGGAGAAGGAGAGAAAAGAGGG - Intergenic
986001105 5:3631612-3631634 AAGGGGAAGGGGAAAAAAGAGGG - Intergenic
986621149 5:9676313-9676335 ATGCTGAAGAAGAACAAAGCTGG + Intronic
986896486 5:12376842-12376864 AGGGTGCAGCAGAAAAATAATGG + Intergenic
986898760 5:12405281-12405303 ATGGTGAAATAAAAGAAAGATGG - Intergenic
986949129 5:13060486-13060508 CTAGTGAAGCAGTAAAAAGGAGG - Intergenic
987424428 5:17756556-17756578 ATTGAGATCCAGAAAAAAGAGGG - Intergenic
987642334 5:20628701-20628723 CTGGTGGAGCAGTAAGAAGAAGG - Intergenic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
987860220 5:23476609-23476631 ATTGAGCAGCAGAAAAAAAAGGG + Intergenic
988477811 5:31603231-31603253 CTAGTGAAGCAGAAAAAAGAGGG - Intergenic
988641424 5:33044884-33044906 AGAATGAAGAAGAAAAAAGAAGG - Intergenic
989756221 5:44958788-44958810 ACGGAGAAGAAGGAAAAAGAAGG - Intergenic
989996391 5:50837744-50837766 CTGGTGCATCAGAAAAAAAATGG + Intronic
991365722 5:65866067-65866089 ATGGGGAAGAAGACAGAAGAGGG + Intronic
991478860 5:67055039-67055061 ATGGTGATGCAAAGAAGAGAAGG + Intronic
991517150 5:67449814-67449836 ATGGGCACACAGAAAAAAGAAGG - Intergenic
992375147 5:76181585-76181607 ATGGTGGAGCAGGAGAGAGAGGG + Intronic
992435575 5:76752634-76752656 GTGGCCAAGAAGAAAAAAGATGG - Intergenic
993465586 5:88242228-88242250 ATGCTGAAGTAGAAATCAGATGG - Intronic
993490822 5:88545738-88545760 ATGGTCATGCAGAAAAGAGCAGG + Intergenic
993634119 5:90324052-90324074 AAGGGGAAACAGAAAAAAGCAGG - Intergenic
993850981 5:93008648-93008670 GTGGTGACCCAGGAAAAAGACGG + Intergenic
994184884 5:96806593-96806615 TTGGTGAAGCTGAAAAAGCAGGG - Intronic
994723663 5:103409585-103409607 ATTCTGAAGTAGAAAACAGATGG + Intergenic
995242285 5:109899061-109899083 ATCATGGAGCAGAAATAAGAAGG + Intergenic
995705270 5:114982326-114982348 ATGGTGAGGCAGAAAGAACCTGG + Intergenic
995774101 5:115707127-115707149 ATTGTGAAGGAAAAAAAAGCAGG - Intergenic
996337485 5:122400633-122400655 ATGGAGAAGCAGAACACAGCTGG + Intronic
996455056 5:123672081-123672103 ATCATGGAGCAGAAAAAAAAAGG - Intergenic
996608081 5:125347180-125347202 ATGTTGCAGCAAAAAGAAGAAGG + Intergenic
997378589 5:133418210-133418232 CTGATCAAGAAGAAAAAAGATGG + Intronic
998864527 5:146483709-146483731 ATGCTGTATCAGAAAAAAAAGGG - Intronic
999637684 5:153639797-153639819 ATGATTAGGCAGAAGAAAGATGG + Intronic
999835255 5:155363553-155363575 ATGGGGAAGGAGGAGAAAGATGG - Intergenic
999938853 5:156518158-156518180 ATGGAAAAACAGAAAAAAGCAGG + Intronic
1000255245 5:159531597-159531619 CTGGTGAAAAAAAAAAAAGAAGG - Intergenic
1000272458 5:159699214-159699236 ATGGTGGAGCAGGCAAAAGTTGG + Intergenic
1000423805 5:161067325-161067347 AAGCTGAAGTAGAAAATAGATGG - Intergenic
1000504495 5:162098252-162098274 ATTGTGAAGCTAAAAAGAGAAGG - Intronic
1000759676 5:165206810-165206832 ATGGAGACGGAGAACAAAGAGGG + Intergenic
1000913057 5:167045500-167045522 AAGGTGAAGGAGAGAGAAGAGGG - Intergenic
1000983916 5:167846425-167846447 ATCCTGAATCAGAAAAGAGAAGG + Intronic
1001349594 5:170946904-170946926 ATTATGAAGCTGAAACAAGAAGG + Intronic
1002408680 5:179056007-179056029 TTGCTGAAGCAGAAAGAAAAGGG - Intergenic
1002494107 5:179600072-179600094 ATTCTGAAGCAGAATAAAGGAGG - Intronic
1002865648 6:1119858-1119880 TTGGTGAATCAGAACAAAGAAGG + Intergenic
1003504488 6:6728451-6728473 ATGTTGAAGCAGAGAATAGAAGG + Intergenic
1004460748 6:15833597-15833619 ATGGTGAATGAGAAGAAAGCAGG - Intergenic
1004521073 6:16361253-16361275 AGGGTGAAAGAGAAAAGAGAGGG + Intronic
1005718385 6:28575808-28575830 ATGGGGAAACAGATAAAATACGG - Exonic
1005757558 6:28938842-28938864 ACGGTGGAATAGAAAAAAGAGGG - Intergenic
1006160908 6:32040177-32040199 GTGGTGAAGCAAAAAAACCACGG - Exonic
1007274803 6:40665467-40665489 ATGGAGAAGCAGTCAAAAGGGGG + Intergenic
1009936482 6:70240695-70240717 AAGGTGAAGCAGGAGAAAGGGGG - Exonic
1010066758 6:71691199-71691221 AAAGTTAAGCAGAATAAAGAGGG + Intergenic
1010309182 6:74363538-74363560 TTGCTGAAGTAGAAAAATGAAGG + Intergenic
1010705670 6:79106444-79106466 ATGTGGGAGCAGAAAAGAGAAGG + Intergenic
1010971961 6:82272341-82272363 ATGATTAAGCAAAAAAAAAATGG + Intergenic
1011287806 6:85743763-85743785 ATGGTGGAGCAGGAGAATGAAGG - Intergenic
1011340719 6:86310648-86310670 ATGGTGAAGCAAGAGAAAGAAGG + Intergenic
1011523380 6:88236215-88236237 TTGGGGAAGAAGAAAAATGAAGG - Intergenic
1011907204 6:92386614-92386636 AGGGTGAACCAAAAAAAAAAAGG + Intergenic
1011947838 6:92929085-92929107 ATGGTGATGTAAAAAAAAAATGG + Intergenic
1012036710 6:94150665-94150687 ATGCTGAGGAAGAAAAAAGAAGG - Intergenic
1012232525 6:96777215-96777237 AAGGAGAAGGAGAAGAAAGAGGG - Intergenic
1012258207 6:97058185-97058207 ATGTTGAAGGAGAACAAAGTTGG - Intronic
1012258734 6:97063392-97063414 ATAGTGATGCAGGAACAAGAGGG + Intronic
1012514860 6:100047660-100047682 ATGGTGAAGCATAAATATTAGGG - Intergenic
1012978211 6:105802581-105802603 CTGATGATGCAGAAAAGAGAAGG - Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013470129 6:110456752-110456774 AAGGTGTAGCAGGAATAAGAGGG - Exonic
1013473054 6:110482604-110482626 ATGGTAATGCAGGAAAAGGATGG - Intergenic
1013696802 6:112712128-112712150 ATGGTGAAGAATAAAATACACGG - Intergenic
1014215038 6:118745189-118745211 AGGGGGAAGGAGAAAAAAGATGG + Intergenic
1014338306 6:120168176-120168198 ATGGTGAATAAGCACAAAGAAGG - Intergenic
1015495461 6:133877755-133877777 ATTGTGAAGCAGAGGAAGGAAGG + Intergenic
1015587606 6:134791545-134791567 AAAGGGAAGCAGAAAAAAGCAGG + Intergenic
1015593179 6:134842047-134842069 AATGTTAAGAAGAAAAAAGAAGG - Intergenic
1015931360 6:138363345-138363367 ATGGTGAACTAGAAAGCAGATGG + Intergenic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018565668 6:165149035-165149057 ACAGTGCAGCAGAAAAAATAGGG - Intergenic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1020354297 7:7260023-7260045 ATACTAAAGCAGAAAAAAAAAGG - Intergenic
1020355014 7:7266308-7266330 GGGGTGAGGCAGGAAAAAGAGGG - Intergenic
1020433623 7:8138566-8138588 ATGCTGTAGTAGAAAAAACATGG - Intronic
1020815779 7:12903713-12903735 GTGTTGAAGCAGAAAAACGTAGG - Intergenic
1021231140 7:18087084-18087106 ATGGTGAGGCAGAAGCAAAAAGG - Intronic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021526320 7:21592872-21592894 ATTTTGTAGCAGAAAAAAAAAGG + Intronic
1021914166 7:25414965-25414987 ATGATGAAGCAGATTAGAGAAGG + Intergenic
1022574812 7:31487349-31487371 ATGGTGAAGGAGAGAGCAGAAGG - Intergenic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1022890379 7:34690771-34690793 AGGGTGAAGAAGAAAAAGTATGG + Intronic
1023054287 7:36279174-36279196 CTGGTGAAGCAGAAAACTCAAGG - Intronic
1023209156 7:37784365-37784387 ATGGTCAAGCATATAAAAGGAGG + Intronic
1024019801 7:45357683-45357705 ATACTGAAGAAGAAAAAAGTTGG + Intergenic
1024798767 7:53051293-53051315 TTGGTGAAGCTGAAAGAAGCTGG - Intergenic
1024830031 7:53440792-53440814 ATGCTGAAGAAGAACAAAGCTGG - Intergenic
1025910713 7:65826238-65826260 ATGGTGAAGGAGCTAAAAGGGGG + Intergenic
1026496185 7:70905559-70905581 ATGGTTGTGCAGAAAAAAAAAGG - Intergenic
1027279864 7:76600367-76600389 GTGCTGGAGTAGAAAAAAGAAGG - Intergenic
1027395131 7:77746400-77746422 ATGGTGATGCAGAACCAAGGGGG + Intronic
1027529277 7:79310587-79310609 TTAGTGAAGCAGAGAACAGATGG + Intronic
1027552852 7:79620435-79620457 ATGGCAAAGCAGGAAAAAAAAGG - Intergenic
1027953063 7:84843821-84843843 AGGGAGAAGCAGAAACAACATGG - Intergenic
1028724555 7:94072524-94072546 ATGGTAAATCAGAAAAAAAAAGG + Intergenic
1028742255 7:94288957-94288979 CTGGGGGAGGAGAAAAAAGAAGG + Intergenic
1028744536 7:94312385-94312407 ATGGTGAAGTAGAAAATAGAAGG - Intergenic
1029806064 7:102997751-102997773 ATGATTAGGCATAAAAAAGAAGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029902286 7:104054246-104054268 ATGCTAAAGCTGAAAAAAGAAGG + Intergenic
1030864527 7:114683362-114683384 ATGGGGTAGCAGAAATAACAAGG + Intronic
1031071117 7:117162983-117163005 ATGGAGAAGCAAAACAAAGTTGG - Intronic
1031105244 7:117533270-117533292 ATAGACAAGCAGAGAAAAGAAGG - Intronic
1031446667 7:121863546-121863568 ATTGTGAAGAAAAAAATAGAGGG + Intergenic
1031482750 7:122299121-122299143 AGGGAGAAGGAGAAAAGAGAGGG - Intergenic
1031604579 7:123753033-123753055 AAGGAGAGGCAGAAAAAAAATGG - Intergenic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1033131336 7:138748220-138748242 GTGGGGAAACAGACAAAAGATGG - Intronic
1033954781 7:146833409-146833431 ATGATAAAGCACAAAAAACAGGG - Intronic
1034215621 7:149403530-149403552 AAGGAGAAACAAAAAAAAGAAGG - Intergenic
1034600313 7:152246313-152246335 ATGATGAAGTAGTAACAAGAGGG + Intronic
1034643747 7:152625924-152625946 ATGGGGAAGCAGGAACAAGGGGG + Intergenic
1034788066 7:153943457-153943479 ATGGAGAAGGACAAAAAAGAGGG - Intronic
1035907804 8:3532395-3532417 ATGGTGAGCTAGAAGAAAGATGG + Intronic
1036925486 8:12901029-12901051 ATTTTAAAGCAGAAATAAGAGGG + Intergenic
1037222382 8:16539962-16539984 ATAATGAAGTAGAAAAAACATGG - Intronic
1037396517 8:18449504-18449526 ATGGTCAAGAAGTCAAAAGAAGG + Intergenic
1038330012 8:26600888-26600910 ATCAGGAAGCAGAAAGAAGAAGG - Intronic
1039353077 8:36783257-36783279 ATCTTGAAACAGAAAAAAAAAGG - Intergenic
1039778556 8:40761010-40761032 AAGCTGAAGAAGAGAAAAGAAGG + Intronic
1040730500 8:50441330-50441352 AAGGTAAAGAAGAAAAATGAAGG - Intronic
1040738755 8:50546031-50546053 TGTGTGAAGCAGAAAAAAGTAGG + Intronic
1041168802 8:55119411-55119433 AATGTTAAGCAGAAAAAAAAAGG + Intronic
1041516191 8:58701139-58701161 ATAGTGAAGAAGCAAAAAAATGG - Intergenic
1042259388 8:66842082-66842104 AGGGTTAGACAGAAAAAAGAAGG - Intronic
1042854441 8:73252001-73252023 GCGGGGATGCAGAAAAAAGAGGG - Intronic
1043033204 8:75164844-75164866 ATGAGGAAGAAGAAAAAAGATGG + Intergenic
1043342469 8:79256743-79256765 ATTATTAAGCTGAAAAAAGAAGG - Intergenic
1044414517 8:91921437-91921459 TTGGTGAAGAAGATTAAAGATGG + Intergenic
1044540146 8:93399516-93399538 ATGGGGAAGCTGCAAGAAGAGGG + Intergenic
1044843177 8:96355436-96355458 ATGCTGAAGAAGAGAAAACATGG + Intergenic
1045188987 8:99864963-99864985 AGGGTGAAGCAGAGTCAAGAAGG - Intronic
1045237039 8:100361281-100361303 AGGGTTCAGCAGAAAAAGGAAGG + Intronic
1045721821 8:105121136-105121158 ATGCTGATGCAGAGAAAAGTAGG + Intronic
1046042409 8:108921846-108921868 ATGGAGAGACAGAAAAAAGAAGG + Intergenic
1046331755 8:112725220-112725242 ATGACTAAACAGAAAAAAGAAGG + Intronic
1046362622 8:113182945-113182967 CTGGTGGAGCAGAAAACAGATGG + Intronic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046681477 8:117175308-117175330 ATGGTGAAGCATATTAAAAATGG - Intronic
1046783882 8:118245144-118245166 CTGGTGAAGCAGAAAATAAATGG - Intronic
1047084725 8:121503913-121503935 ATGCTGAAGGAGACAAAAGGAGG + Intergenic
1047363472 8:124190965-124190987 AGAGAGAAGAAGAAAAAAGAAGG + Intergenic
1047390923 8:124450714-124450736 ATGGTTGACCATAAAAAAGATGG + Intergenic
1047721182 8:127641356-127641378 ATATTGAAGCAAAAAACAGAAGG + Intergenic
1047771506 8:128033775-128033797 ATGGTGAAGGGGAACAAAGGAGG - Intergenic
1047874991 8:129126296-129126318 AAGAAGAAGAAGAAAAAAGAAGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048504279 8:135006648-135006670 CTGGTGCAGCAGAAACAAAATGG + Intergenic
1049031897 8:140044146-140044168 GCTGTGAAGCAGAAGAAAGAGGG - Intronic
1049077251 8:140408434-140408456 AAGATAAAGCAAAAAAAAGAAGG + Intronic
1050876140 9:10639306-10639328 ATAGTGAACCAGAAAAAGCAAGG + Intergenic
1051347131 9:16162389-16162411 ATGGTGAAGAAAAATAAAGCAGG + Intergenic
1051938663 9:22476382-22476404 AAAATGAAGCAGAAAAATGAAGG - Intergenic
1052349727 9:27446345-27446367 ATCCTGCAGCAGAAAGAAGATGG + Intronic
1052944138 9:34153878-34153900 ATGGTGTAACAGAAAAAGCATGG + Intergenic
1053750017 9:41243742-41243764 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054255516 9:62808080-62808102 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054335789 9:63807528-63807550 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1054994432 9:71369251-71369273 CTGATGGAGGAGAAAAAAGAGGG + Intronic
1055393999 9:75854077-75854099 ATGGTAAAGAAGAAATAAGGGGG - Intergenic
1055825997 9:80325551-80325573 ATGGGGAAGGAGGAAAAACAAGG + Intergenic
1055863899 9:80789093-80789115 ATGTTGACTTAGAAAAAAGACGG + Intergenic
1056175053 9:84026412-84026434 AAGATGAAGAAGAAGAAAGAAGG - Intergenic
1056305986 9:85290790-85290812 ATGGCTAAGCAGAAAAGAGATGG + Intergenic
1056450904 9:86715893-86715915 AGGTTGAAGAAGGAAAAAGAAGG - Intergenic
1057125811 9:92615144-92615166 ATTGTAAAGCAAAAAAAAAAAGG + Exonic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057894653 9:98899051-98899073 ATGGAGAGGCTGTAAAAAGAAGG + Intergenic
1058274746 9:103025459-103025481 ATGGTCCAGCAGCAATAAGATGG + Intergenic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1058857822 9:109083102-109083124 AAGGTCAAGCAAAAAAAAAATGG + Intronic
1059510184 9:114837897-114837919 TTGGTGAAGAAGAAAGATGAGGG - Intergenic
1059632867 9:116143260-116143282 AGGGTGAAACAGAAAAGAGGTGG - Intergenic
1059851400 9:118345203-118345225 AGGGTGAAGCAGGAGAGAGAAGG + Intergenic
1060373506 9:123097802-123097824 ATGCAGAAGAAGAGAAAAGACGG + Exonic
1060507131 9:124206319-124206341 ATGGGGAAGCAACACAAAGAAGG + Intergenic
1060579494 9:124731622-124731644 ATGCTGAAGGAGGAGAAAGAGGG - Intronic
1203375716 Un_KI270442v1:374937-374959 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1185868063 X:3640165-3640187 AGGGGCAAGCAGAAGAAAGAAGG + Intronic
1186144287 X:6609632-6609654 ATGGTGAATCAAGAAAGAGAGGG + Intergenic
1186289503 X:8081019-8081041 ATGGGGAAGCAGAGCACAGAAGG + Intergenic
1186619526 X:11224180-11224202 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186619530 X:11224242-11224264 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186652691 X:11578016-11578038 ATTTTGAAGGAAAAAAAAGAAGG + Intronic
1187025825 X:15434363-15434385 AAGGAGGAGGAGAAAAAAGAAGG + Intronic
1187167544 X:16818543-16818565 AAGGAGAAGGAGAAAAAAGATGG - Intronic
1187348342 X:18488505-18488527 CTGGTCAACCAGAAAGAAGAAGG + Intronic
1187574299 X:20538206-20538228 AAGGTTAAGAAGAAAAAATATGG + Intergenic
1189524133 X:41801656-41801678 ATGGTGGAGCAGATAACAGGAGG + Intronic
1189713599 X:43841363-43841385 AAGCTGAAGCAAAAACAAGAAGG + Intronic
1190373467 X:49765317-49765339 AAGGAGAAGCAGATAAAAAAGGG + Intergenic
1190445075 X:50515696-50515718 CAGTTGAAGCAGAAAAGAGAAGG + Intergenic
1190584666 X:51927202-51927224 ATGGAGATGAAGAAAACAGAAGG + Intergenic
1191795527 X:65017859-65017881 AGGGTGAAACAGAAAAAAATTGG + Intronic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1193545270 X:82818991-82819013 ATGGTTACGGAGAAAAAATATGG - Intergenic
1193817431 X:86121188-86121210 TTGAACAAGCAGAAAAAAGAAGG - Intergenic
1193961314 X:87928206-87928228 AGATTGAAGCAGAAAAAAAATGG + Intergenic
1194144782 X:90248328-90248350 TTGGTGTCCCAGAAAAAAGATGG + Intergenic
1194608228 X:96007403-96007425 ATGGAAAAACAGAAAAAAGTAGG + Intergenic
1194763987 X:97827832-97827854 AGGCTGAAGAAGAATAAAGAAGG + Intergenic
1195326586 X:103763400-103763422 ATGGTGGTGCAGAATATAGAAGG + Intergenic
1195328305 X:103775849-103775871 ATGGCTAAGCAGCAAAAACAGGG - Intronic
1195656995 X:107341215-107341237 ATGGAGAAAGAGACAAAAGATGG + Intergenic
1195713572 X:107796182-107796204 ATGGTGGAGCAAAACAAAAATGG - Intergenic
1196205205 X:112931519-112931541 ATGGTGAACAAGAAAGAAGATGG - Intergenic
1196273330 X:113737445-113737467 AGGGGGAAGCAGTAAAATGATGG - Intergenic
1196438285 X:115694342-115694364 AAAGTGAAGGAGAAAAAACAAGG + Intergenic
1196473595 X:116057413-116057435 ATGGTGGAGCAGGAGAAAGATGG - Intergenic
1196731105 X:118942311-118942333 AAGGAGAAGGAGAAGAAAGAAGG + Intergenic
1197181465 X:123541401-123541423 ATGATGCAGGAGTAAAAAGAGGG + Intergenic
1197395834 X:125925864-125925886 ATGGAAAAATAGAAAAAAGAAGG - Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198112773 X:133516255-133516277 ATGGGAAAGCAGAACACAGAGGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199401184 X:147400739-147400761 GTGCTTAAGCAGAGAAAAGATGG - Intergenic
1199410803 X:147519916-147519938 ATGGGAAAACAGAAAAAAGCAGG + Intergenic
1199589994 X:149458757-149458779 ATGGTGTGACAGAATAAAGATGG + Intergenic
1199877234 X:151943459-151943481 AGGGTAAAGAAGAAAAATGATGG - Intergenic
1199881881 X:151980238-151980260 ATGGTGAAGATAAAAACAGAGGG + Intergenic
1200297040 X:154930485-154930507 ATGGTCCAACAGAAAAAAGAGGG - Exonic
1200559906 Y:4688913-4688935 ATAATGAAGCAGATAAAAAATGG + Intergenic
1201066313 Y:10098629-10098651 ATGGAGAACCAGGAGAAAGAAGG - Intergenic