ID: 1089037368

View in Genome Browser
Species Human (GRCh38)
Location 11:115408641-115408663
Sequence ATGAATAAGTACTAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089037368 Original CRISPR ATGAATAAGTACTAGGAGGA GGG (reversed) Intronic
901145894 1:7064501-7064523 AGGAAGAAGTGCTGGGAGGAGGG + Intronic
905541742 1:38765404-38765426 ATGAATGTGTCTTAGGAGGATGG - Intergenic
906772647 1:48498961-48498983 GTGAATAAATACTAGGAGAGAGG - Intergenic
907662897 1:56409516-56409538 ATGAATGAGTAGTTGGGGGAAGG - Intergenic
907688553 1:56638398-56638420 ATGGAAAATTACTAGGAGGGTGG - Intronic
908340377 1:63172367-63172389 ATAAGTAAGTACTTGGAGGCAGG - Intergenic
908527740 1:65003541-65003563 ACGAATGAGTATTTGGAGGAGGG + Intergenic
909162549 1:72172081-72172103 ATGAATCAGCAGTAGGTGGAAGG + Intronic
910021792 1:82599673-82599695 ATGAATGAGGACAAGAAGGAAGG - Intergenic
911286855 1:96005484-96005506 ATAAATAAGTAAAAGGAAGATGG - Intergenic
911768839 1:101713310-101713332 ATGAATTAGAAGCAGGAGGAAGG - Intergenic
911882546 1:103259628-103259650 ATGAATAAGTAGGAGGGGGCAGG + Intergenic
912000807 1:104832507-104832529 ATGAACACAGACTAGGAGGATGG + Intergenic
917863396 1:179170291-179170313 TTGAAAAAGTAGTAGGAGGTGGG - Intronic
919412053 1:197257796-197257818 AAGGATAAGTAATAGGTGGAGGG - Intergenic
919543521 1:198881305-198881327 ATAAATAAGTGTGAGGAGGAAGG - Intergenic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
923297103 1:232604738-232604760 ATGAGATAGTACTAGGAGGCTGG - Intergenic
923609962 1:235482198-235482220 AAGAATCAGTACTTGGAAGAAGG + Intronic
1063313741 10:4982303-4982325 TTCAATAAGTACTTGGCGGAGGG + Exonic
1065863859 10:29896194-29896216 ATGAGTAAGTGCTTGAAGGAAGG + Intergenic
1068030212 10:51697572-51697594 AAGATTAGGTTCTAGGAGGAGGG + Exonic
1068519896 10:58066551-58066573 AACAATAAGTCTTAGGAGGAGGG - Intergenic
1068634413 10:59332783-59332805 AGGAATAAGTTCTAGCAGAAAGG - Intronic
1073372517 10:103003412-103003434 TTAAAAAAGTACTAGAAGGAGGG - Intronic
1075064213 10:119278639-119278661 ATGAATGAGTGATAGGTGGAAGG - Intronic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077828198 11:5833287-5833309 ATGAAAATATAATAGGAGGAAGG + Intronic
1080312871 11:30914378-30914400 ATGAATCAGTACTTTGAGGGAGG - Intronic
1081616402 11:44593840-44593862 GTTAATAAGTACTAATAGGATGG + Intronic
1082282296 11:50282921-50282943 TTTAATAAGTACTTGAAGGAAGG - Intergenic
1082595114 11:55068904-55068926 AGGAATAAAAACTAGAAGGAAGG - Intergenic
1084395736 11:68908795-68908817 AGGACTGAGTACAAGGAGGACGG - Intronic
1085160627 11:74340741-74340763 ATAAAACAGTAATAGGAGGAAGG + Intronic
1085254847 11:75166626-75166648 ATGGATGAGTAGTAGGTGGATGG - Intronic
1085746039 11:79115160-79115182 GTGAATAAGCACTTGGATGACGG + Intronic
1085841315 11:80014466-80014488 AGGAATAAGTACTATAAGGCAGG - Intergenic
1088077170 11:105864539-105864561 ATGATAAAGTTCTAGAAGGATGG + Intronic
1088146673 11:106689025-106689047 ATGAATCTGTCTTAGGAGGATGG - Intronic
1089037368 11:115408641-115408663 ATGAATAAGTACTAGGAGGAGGG - Intronic
1090161017 11:124495636-124495658 ATGAAGAATCACTTGGAGGAGGG - Intergenic
1090182735 11:124715090-124715112 AGGAATAAATTCAAGGAGGATGG + Intergenic
1090312542 11:125754602-125754624 ATGATTCAGTTCTAGGAGGTTGG + Intergenic
1093101135 12:15030570-15030592 AATAATAAGTCCTAGGATGAGGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094370370 12:29731014-29731036 ATGAATTGGAACTTGGAGGAAGG + Intronic
1100069506 12:90694855-90694877 ATGAATATATAATTGGAGGAAGG - Intergenic
1100306935 12:93358974-93358996 ATGACCATGTACTAGGAAGATGG + Intergenic
1101738640 12:107482590-107482612 ATGCATATTTACTAGAAGGAAGG - Intronic
1102751490 12:115298514-115298536 ATGAATAATAAGTTGGAGGATGG - Intergenic
1104145389 12:126029163-126029185 ATGAAATAGCACTAGGGGGATGG + Intergenic
1104477687 12:129084072-129084094 ATGAACAAATTCTAGGAGAAGGG - Intronic
1104754208 12:131258703-131258725 ATGAATAAGTAAATGGAGAAGGG - Intergenic
1107293134 13:38880126-38880148 TTGAATGAGTACTAGGTGCAAGG - Intronic
1107850614 13:44568946-44568968 ATTGATAACTACTGGGAGGAAGG + Intronic
1108092087 13:46859558-46859580 ATGAAACAGCACTAGGGGGATGG - Intronic
1109634039 13:65090004-65090026 TTGAATATCTACTATGAGGAAGG - Intergenic
1110068529 13:71142104-71142126 ATGATTAAGTAATAGCAGGTGGG + Intergenic
1110360130 13:74615367-74615389 ATGAATGTGTACCAGGTGGAGGG + Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1115024625 14:28728821-28728843 ATGAAAAAATAATAGAAGGAAGG + Intergenic
1116505110 14:45668239-45668261 GTGAATAATTACTGGGTGGATGG - Intergenic
1119090264 14:71774259-71774281 CTGCATGAGCACTAGGAGGATGG + Intergenic
1119851048 14:77866993-77867015 ATGAGTAAATAAGAGGAGGATGG - Intronic
1120230399 14:81835419-81835441 ATGAAACAGCACTAGGGGGATGG - Intergenic
1120290946 14:82569957-82569979 ATGAACCAGCACTAGGGGGATGG - Intergenic
1120880420 14:89411491-89411513 CTGAATATGAACTAGGAGAAGGG - Intronic
1121543584 14:94747052-94747074 ATGAATAAGTGGTAGGAAGGTGG + Intergenic
1121746006 14:96293508-96293530 ATGAATAAATGTTTGGAGGAAGG + Intronic
1125370061 15:38965709-38965731 ATGAGATGGTACTAGGAGGAGGG - Intergenic
1126507794 15:49428078-49428100 ATAAATAAGAACTATGAAGATGG + Intronic
1127985006 15:64062413-64062435 ATTAATGAGTATTAGGAGGTGGG - Intronic
1128365242 15:66995276-66995298 ATGAATGAGAAATAGGGGGATGG - Intergenic
1128988378 15:72237677-72237699 ATGGAAAATTACCAGGAGGAGGG + Intergenic
1129491028 15:75925848-75925870 ATGAAAAATTCCTAAGAGGATGG + Intronic
1129990936 15:79962426-79962448 ATGAGTATGTACTGGCAGGAGGG - Intronic
1130321278 15:82844184-82844206 CTGAATGAGTACAAGGGGGATGG + Intronic
1131540647 15:93272325-93272347 ATGAATCAAGACCAGGAGGAGGG + Intergenic
1135319681 16:21484782-21484804 ATGAATAACTACTGGGATTAGGG + Intergenic
1135372518 16:21916271-21916293 ATGAATAACTACTGGGATTAGGG + Intergenic
1135439268 16:22454433-22454455 ATGAATAACTACTGGGATTAGGG - Intergenic
1138029205 16:53546432-53546454 CTGAATAAGTAATTGTAGGATGG - Intergenic
1138873467 16:60920955-60920977 ATGAAGAATTCCTAGAAGGAGGG + Intergenic
1139072893 16:63404371-63404393 TAGAATAAAGACTAGGAGGAGGG - Intergenic
1139137867 16:64226399-64226421 ATGAAATAGTACTAAGAGGTGGG + Intergenic
1139328573 16:66170264-66170286 ATGAATAACTACTAGGAATCTGG + Intergenic
1140941854 16:79729162-79729184 AAAAATAAGTGCTAAGAGGATGG + Intergenic
1148623632 17:49053104-49053126 ATTGATAAGGACTGGGAGGAGGG - Exonic
1148977140 17:51539383-51539405 ATGTAAAAGTACTAGGAGGTGGG - Intergenic
1149453539 17:56768789-56768811 ATCAACAAGTACTAGGAGAGGGG + Intergenic
1149453716 17:56770426-56770448 ATGAATAGGTGATAGGTGGATGG - Intergenic
1150461640 17:65358695-65358717 ATGAAACAGCACTAGGAGGATGG + Intergenic
1150989975 17:70246028-70246050 AAGAAAAAGTATTAGTAGGAAGG - Intergenic
1151807231 17:76413484-76413506 AAGAATAAGTACTATTAGGTTGG + Intronic
1153112168 18:1604664-1604686 ATAAATAAATACTAGGAGGCAGG - Intergenic
1154262932 18:12853755-12853777 ATGAATAATTTCTAGGAAAATGG + Intronic
1155240695 18:23861319-23861341 ATGAATAAAAACTAGGACCATGG - Intronic
1155726424 18:29090579-29090601 CTGAACAACTACTAGGTGGAGGG + Intergenic
1157541907 18:48516688-48516710 AGGAATCAGATCTAGGAGGAAGG + Intergenic
1158364201 18:56712889-56712911 ATGAACATTTACTAGAAGGAGGG + Intronic
1163464087 19:17456026-17456048 CTGCCTAAGTACTGGGAGGAGGG - Intronic
1164790499 19:30973566-30973588 GAGAATCAGTACTAGTAGGATGG - Intergenic
1167944190 19:52974391-52974413 TTCAATAAATACTTGGAGGACGG - Intergenic
1168443903 19:56395481-56395503 GAGTATAAGTACTAGGAGGCAGG + Intergenic
1168663476 19:58184819-58184841 ATGAATAAGAAATAGGGGGCCGG + Intronic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
926994367 2:18717966-18717988 ATGGATAAGACCTAGGAGGGAGG + Intergenic
927017347 2:18978980-18979002 ATAAATAAATAAAAGGAGGAGGG - Intergenic
927038556 2:19205274-19205296 AAAAATGAGTACTAGAAGGAAGG + Intergenic
927654184 2:24931505-24931527 ATTAATAAATGCTTGGAGGAAGG + Intergenic
928721218 2:34123881-34123903 CTGATTAATTTCTAGGAGGATGG - Intergenic
930242951 2:48955151-48955173 ATGACTAAGCACTAGGAAGCAGG - Intergenic
931092246 2:58898806-58898828 CTGAATAGGGACTAGGAAGAGGG - Intergenic
932667276 2:73707987-73708009 GTGAATGTGAACTAGGAGGAAGG + Intergenic
932803999 2:74767517-74767539 ATGAGTAAGTATTGGGAGTAGGG - Intergenic
933127406 2:78626511-78626533 ATGAATAAAAAATGGGAGGAAGG + Intergenic
933222200 2:79703449-79703471 GCAAATAAGTACTAGGAGAAAGG - Intronic
934117525 2:88811163-88811185 CTGAACAAGTACCAGGAGCAAGG + Intergenic
934916350 2:98303970-98303992 ATGAATAAGTAGCAGGTGAAAGG - Intronic
936403791 2:112185078-112185100 AAGAATAAGTGCCAGGAGCAGGG + Intronic
936601101 2:113895443-113895465 ATGAACAAGAATTAGGAGTATGG + Intronic
937570402 2:123351226-123351248 ATGAGACAGCACTAGGAGGATGG - Intergenic
937756877 2:125550303-125550325 ATGAGAAAGCACTAGGGGGATGG + Intergenic
939701456 2:145397563-145397585 ATGATGAAATATTAGGAGGATGG + Intergenic
940389206 2:153111950-153111972 TTAAATAAGTACTAGGATAATGG - Intergenic
940787153 2:157993907-157993929 ATGAGACAGTACTAGGGGGATGG + Intronic
942147067 2:173037444-173037466 AGGAGTAAGGACTAGGAGGAGGG - Intronic
942501307 2:176593680-176593702 ATGATTAAATACAAAGAGGATGG + Intergenic
942679679 2:178463998-178464020 ATGAAGAAATATTGGGAGGAAGG + Exonic
944036472 2:195300467-195300489 ATGAATAAACTCTTGGAGGAAGG + Intergenic
945201133 2:207282620-207282642 ATCATTTAGTACTAGGAGGGGGG + Intergenic
946210893 2:218146434-218146456 ATGAATAAGTATTGGAAGAAAGG + Intergenic
946950842 2:224873112-224873134 TTAAATAAATACTAGTAGGATGG - Intronic
1169118014 20:3079087-3079109 AAGAACAAGTAATAGGAGGCTGG - Intergenic
1169179118 20:3546835-3546857 AGGAATATGTACCATGAGGATGG + Intronic
1172857893 20:38021976-38021998 ATGAATACGAACAAGGAAGAGGG + Intronic
1175732067 20:61360940-61360962 ATGAAAATGTAGCAGGAGGAGGG + Intronic
1178434932 21:32549800-32549822 ATTAATGTGTACTAGGAGCATGG - Intergenic
1178964745 21:37105647-37105669 ATGGATCATGACTAGGAGGAGGG - Intronic
1179566300 21:42251211-42251233 TTGAACAAGTGCTTGGAGGAAGG + Intronic
1182748478 22:32623737-32623759 TTGAATAAGTCCTATGAAGATGG - Intronic
1182784223 22:32893217-32893239 ATGGATAAGTCCTGGGAGGGGGG - Intronic
1184260294 22:43311375-43311397 ATGGATGAATACTAGGTGGAAGG + Intronic
951824999 3:26859056-26859078 AGGAAGAATCACTAGGAGGAAGG + Intergenic
953072683 3:39537818-39537840 GGGCATAAATACTAGGAGGAGGG - Intergenic
954409984 3:50366328-50366350 CAGAGTAAGTCCTAGGAGGAAGG + Exonic
955195250 3:56800149-56800171 AGGACTAAGTAATAGTAGGAAGG + Intronic
958747205 3:98151523-98151545 ATGAATGAGTGCTAGAAGGGTGG - Intergenic
958752538 3:98209562-98209584 ATAAATGAGTGCTAGAAGGATGG - Intergenic
958754948 3:98240498-98240520 ATGAATGAGTACTAGAAGAATGG - Intergenic
958801643 3:98763263-98763285 AGTAATAAGTACAAAGAGGAAGG + Intronic
961351022 3:126302757-126302779 ATAAGTAAGAAGTAGGAGGATGG - Intergenic
962507272 3:136060475-136060497 ATGAGACAGCACTAGGAGGATGG - Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963990063 3:151642714-151642736 TTGAATAAGTACATGGAGGTTGG - Intergenic
964046068 3:152328639-152328661 ACGGAGAAGTACTAGGAAGAAGG + Intronic
965961521 3:174434751-174434773 ATGCAAAACTACTAGAAGGAAGG + Intergenic
970943185 4:21659852-21659874 ATGATTAATTAATAAGAGGATGG + Intronic
972776978 4:42250408-42250430 ATGATTAAGTGCTAATAGGAAGG + Intergenic
973606484 4:52592498-52592520 ATGAGGCAGTACTAGGGGGATGG - Exonic
976508520 4:85880027-85880049 ATGGATCAGTACCAGGAGGTTGG + Intronic
977265627 4:94850023-94850045 ATCAACAAGAACTGGGAGGAAGG - Intronic
977362882 4:96028979-96029001 ACGAAACAGTATTAGGAGGATGG + Intergenic
977598185 4:98907053-98907075 CTGAATAAATACTTGGAGAATGG - Intronic
977842854 4:101730070-101730092 ATAACTAACTACTAGGGGGACGG - Intronic
977871485 4:102095742-102095764 ATGACTAGGTAGTTGGAGGATGG + Intergenic
978725473 4:111964359-111964381 AAAAATTAGGACTAGGAGGATGG + Intergenic
980669683 4:135988022-135988044 ATGAAGTAGTAGTAGGAGAAAGG - Intergenic
980766739 4:137316173-137316195 ACCAATAAGTACGTGGAGGAAGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981136665 4:141218771-141218793 TTTAATAAGTCCTAGGTGGAAGG - Intergenic
986753538 5:10812259-10812281 ATGAATGAGTTCCAGGGGGAAGG + Intergenic
986808934 5:11335519-11335541 ATAAATAAGGACTTTGAGGATGG + Intronic
987261872 5:16212532-16212554 AAGAATAAGTTTCAGGAGGAAGG - Intergenic
987787139 5:22515362-22515384 ATAAATAAGTACAAGGGAGATGG + Intronic
990411212 5:55543190-55543212 AAGAATGAGTGCTAGGAGAAGGG - Intergenic
990947509 5:61264196-61264218 AGAAATAAGAGCTAGGAGGAGGG + Intergenic
993426304 5:87768843-87768865 ATGAAAAATTACTAGGTAGATGG + Intergenic
994801680 5:104385132-104385154 AAGAATAAGTAGGAAGAGGAGGG - Intergenic
995518307 5:112976083-112976105 ATGAATAAGGACGAGCAGGTGGG + Intergenic
995872679 5:116759300-116759322 TTGACAAAGTACTAGGAGAATGG - Intergenic
996412997 5:123179399-123179421 ATGGATAAATATTTGGAGGAGGG + Intronic
997087208 5:130815798-130815820 AGCAATAAGATCTAGGAGGATGG + Intergenic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
1000413498 5:160959003-160959025 ATGATAAAGTACTGGGATGAAGG + Intergenic
1002827389 6:785719-785741 ATGAATAAGTACAAGAAAAAAGG - Intergenic
1004258968 6:14090859-14090881 ATCAATATGTATTAGGAGGTGGG - Intergenic
1006066433 6:31465630-31465652 ATGGATGAGTAAGAGGAGGAAGG - Intergenic
1006294010 6:33161797-33161819 AGGAAGAAGTACGGGGAGGAGGG + Intergenic
1006299594 6:33186492-33186514 ATGAATGAGGACTAGGAGGAGGG + Intronic
1007434326 6:41797837-41797859 CTGAATAAGTACTATGTGGTAGG + Intronic
1007699691 6:43759351-43759373 ATGCATATGTATTATGAGGAAGG - Intergenic
1007785888 6:44279121-44279143 ATGAATCAGCCCAAGGAGGATGG + Exonic
1007883644 6:45198428-45198450 ATAACAAAGTATTAGGAGGAAGG - Intronic
1008067423 6:47063959-47063981 ATGAAACAGCACTAGGGGGATGG + Intergenic
1009063742 6:58430612-58430634 ATGGATAAATACTAGAAGGAAGG - Intergenic
1009251407 6:61305198-61305220 CTGGATAAATACTAGAAGGAAGG - Intergenic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009771475 6:68147991-68148013 ATGAATAAAAACTTGGAAGATGG + Intergenic
1010918095 6:81645600-81645622 ATGAGTAAGTACCATGAGAAAGG + Intronic
1011165622 6:84442715-84442737 ATGAACAGGAATTAGGAGGAGGG + Intergenic
1012163005 6:95911350-95911372 ATGATTTTGTACTAAGAGGAGGG + Intergenic
1012578588 6:100834133-100834155 ATGAATAAGTAATAAAAGGAGGG + Intronic
1013419349 6:109951855-109951877 AACAAGCAGTACTAGGAGGATGG - Intergenic
1014007889 6:116442343-116442365 AGGAATAAGTAGTAGGAAGCGGG + Intergenic
1014260149 6:119207188-119207210 ATGAATGTGTACAAAGAGGAAGG - Intronic
1014610128 6:123533113-123533135 ATTAATACCTACTAGGAGTAAGG - Intronic
1015603713 6:134935058-134935080 GAGAACAAGTACTTGGAGGAGGG - Intronic
1015973986 6:138770885-138770907 ATGTATGAGTACTGGGAGGCAGG + Intronic
1016138494 6:140577737-140577759 ATGAATAAGAACTAGTGAGAGGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016501021 6:144720782-144720804 ATGAATAAATACACAGAGGAGGG - Intronic
1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG + Intergenic
1017574125 6:155782572-155782594 ATGGAAAATTACTAAGAGGAAGG - Intergenic
1018752948 6:166822959-166822981 ATGAAGAAGTGCTAGAATGAGGG + Intronic
1019055263 6:169218856-169218878 ATGGATAAGTGCTGGGTGGATGG + Intronic
1022450569 7:30510241-30510263 ATAAATAAGTGCTTGGAGTAAGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023215604 7:37859307-37859329 AAGAATAAGCATTAGAAGGATGG - Intronic
1023578723 7:41658274-41658296 CTGAGTAAGTACCAGGAGTAGGG - Intergenic
1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG + Intronic
1024412032 7:49054753-49054775 CTGAGTAAGTACTGGAAGGATGG + Intergenic
1024585160 7:50835764-50835786 CTGAATAAGCACTGGGAGGTGGG - Intergenic
1024967868 7:55040362-55040384 AGGGATAATTAATAGGAGGAAGG + Intronic
1026820712 7:73546175-73546197 ATGTGTAACTACGAGGAGGACGG - Intronic
1026844623 7:73691437-73691459 AAGGATCAGCACTAGGAGGAGGG - Intronic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028848095 7:95505690-95505712 ATGAATAAGTATTTGGGGGGGGG - Intronic
1032790892 7:135241672-135241694 GTGAAAATGTACAAGGAGGAGGG - Intronic
1033497617 7:141915681-141915703 ATGAGGAAGTCCGAGGAGGATGG - Intronic
1033863098 7:145653691-145653713 AGGAAAAAGAAGTAGGAGGAAGG - Intergenic
1035489780 7:159264290-159264312 ATTAATAAGTATTTGGAGGTAGG + Intergenic
1036741780 8:11369369-11369391 ATGAATATGTGCCAAGAGGAAGG - Intergenic
1037788661 8:21918535-21918557 AGGAAGACCTACTAGGAGGACGG + Intergenic
1038023986 8:23572944-23572966 AGAAATAAGTCCTAGGATGAAGG - Exonic
1038175860 8:25181918-25181940 ATGAAAAAGAACCAAGAGGAGGG - Intergenic
1038735076 8:30161412-30161434 ATGAAGAAGTACTTGGTGGTGGG - Intronic
1038883547 8:31639851-31639873 ATAAATAAATAAAAGGAGGAGGG + Intronic
1041199149 8:55433715-55433737 TTAAATGAGTATTAGGAGGAAGG + Intronic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1047993292 8:130309281-130309303 ATGAATAAGTACTAAGACAGAGG + Intronic
1048015972 8:130498336-130498358 ATAAATAAATAAAAGGAGGAGGG - Intergenic
1048671137 8:136721738-136721760 ATGAATCAGTACTCTGAAGAGGG - Intergenic
1050952636 9:11617466-11617488 ATGAATTAGTACTAGGCAGGAGG - Intergenic
1051097847 9:13487019-13487041 AAAAATAAGTAAAAGGAGGAAGG + Intergenic
1051846242 9:21454620-21454642 ATGAATATATTCTAGAAGGAGGG + Intergenic
1053539701 9:38960593-38960615 ATGTACCAGCACTAGGAGGATGG - Intergenic
1054626440 9:67403325-67403347 ATGTACCAGCACTAGGAGGATGG + Intergenic
1055491454 9:76808995-76809017 AAGAATATGAACTAGGAGGGAGG - Intronic
1055492085 9:76815566-76815588 ATGAAGTAGTACTAAGAGGTAGG - Intronic
1059996785 9:119918333-119918355 ATGAATCAATAGTAGGAGCAGGG - Intergenic
1185936383 X:4261830-4261852 ATGTATTAGTATTAGGAGGTGGG + Intergenic
1186141587 X:6580119-6580141 ATGAAACAGCACTAGGGGGATGG + Intergenic
1186145001 X:6615879-6615901 ATGAGACAGCACTAGGAGGATGG - Intergenic
1186156956 X:6735661-6735683 ATGAATTACTACAAGGTGGAGGG - Intergenic
1186462530 X:9759747-9759769 AAGAATGAGTACGGGGAGGAGGG + Intronic
1188005907 X:25015712-25015734 AGCAATCAGTACCAGGAGGAGGG - Exonic
1188661194 X:32760897-32760919 ATGAAGAAGAAATAAGAGGAAGG - Intronic
1191781585 X:64873912-64873934 ATGACTCAGTATTTGGAGGAAGG + Intergenic
1194150687 X:90322625-90322647 ATGAGACAGCACTAGGAGGATGG + Intergenic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1200497054 Y:3899386-3899408 ATGAGACAGCACTAGGAGGATGG + Intergenic
1200985910 Y:9303531-9303553 ATGAGAAAGTCCTTGGAGGAAGG + Intergenic
1201300261 Y:12498784-12498806 ATGACGAAGAAGTAGGAGGAAGG - Intergenic
1201449080 Y:14090418-14090440 ATGAATATGTACTATAAGTAAGG - Intergenic
1202124669 Y:21557364-21557386 ATGAGAAAGTCCTTGGAGGAAGG - Intergenic
1202154339 Y:21872016-21872038 ATGAGAAAGTCCTTGGAGGAAGG + Intergenic