ID: 1089040439

View in Genome Browser
Species Human (GRCh38)
Location 11:115443724-115443746
Sequence GCAGACTGCTTGGCACATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089040439_1089040442 18 Left 1089040439 11:115443724-115443746 CCAGTATGTGCCAAGCAGTCTGC 0: 1
1: 0
2: 2
3: 34
4: 265
Right 1089040442 11:115443765-115443787 GATAACTCAGCCAAATAGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089040439 Original CRISPR GCAGACTGCTTGGCACATAC TGG (reversed) Intronic
900773275 1:4562753-4562775 GCTGAGTGCCTGACACATACCGG + Intergenic
905851953 1:41281268-41281290 GCTGACTTCTTGGCATATAGTGG - Intergenic
906554099 1:46693782-46693804 GCAAAGTGCCTGGTACATACTGG + Intronic
906610887 1:47201476-47201498 GCACAGTGCCTGGCACATAGTGG - Intergenic
906645449 1:47471274-47471296 GCAGACTCCTTAGCACAGCCTGG + Intergenic
906710511 1:47926519-47926541 ACAGAGTGCTTGGCACAGCCAGG - Intronic
908411040 1:63865726-63865748 GTACAGTGCTTGGCACATAGCGG + Intronic
911056674 1:93714410-93714432 GAACACTGCCTGGCACATAGTGG + Intronic
911632279 1:100196730-100196752 GAAGAATACTTGGCACATAGTGG - Intronic
912200139 1:107447971-107447993 GCACAATGTCTGGCACATACTGG - Intronic
912246883 1:107968875-107968897 GAAGAGTGCTTGACACATAGTGG - Intergenic
912713471 1:111965896-111965918 GCAGAGTGCCTGGCACACAGAGG - Intronic
913119918 1:115730456-115730478 GAAGAGTGCCTGGCACATAAAGG + Intronic
913264319 1:117029608-117029630 GCACAGTGCCTGGCACATAGGGG + Intronic
914937226 1:151992386-151992408 GCAGGCTGCCAGGCGCATACTGG + Intronic
914963196 1:152225393-152225415 GTATACTGCTTGTCACATAACGG + Intergenic
916417697 1:164608215-164608237 GCACAGTACTTGGCACATGCTGG - Intronic
919767827 1:201138662-201138684 GCAGAGCGCCTGGCACATAGTGG - Intronic
919827522 1:201514007-201514029 GCCCAGTGCTTGGCACATAGTGG - Intergenic
923356543 1:233161490-233161512 ACACACTCATTGGCACATACTGG + Intronic
1064364084 10:14691480-14691502 GCTCACTGCCTGGCTCATACTGG - Intronic
1065240605 10:23699921-23699943 GCATACTGTTTGGCACACAATGG + Intronic
1070005149 10:72417040-72417062 GAAGACTGCTTGGCACATAGTGG + Intronic
1070341730 10:75504305-75504327 GCATAATGCATGGCACATAGAGG - Intronic
1070573055 10:77656059-77656081 GCAGAGTACCTGGCACATAGTGG - Intergenic
1071100956 10:82037191-82037213 TCAGACTGCCTGGCAGATCCTGG + Intronic
1072449063 10:95524814-95524836 GCATAGTGCCTGGCACATAATGG + Intronic
1073017718 10:100415101-100415123 AGTGACTGCTTGGCACATACTGG + Intergenic
1073898954 10:108196728-108196750 TAAGACTCGTTGGCACATACTGG + Intergenic
1074787148 10:116850912-116850934 GCAGAGTGCATGGCACACAGTGG + Intronic
1074956491 10:118395929-118395951 GAAGAGTGCTTGGCACATCGTGG + Intergenic
1075169051 10:120096550-120096572 GCAGACGGCATGGAACATTCTGG + Intergenic
1077522529 11:3044858-3044880 GCAGACTGCTTGCCACTTCCTGG - Intronic
1078468837 11:11570790-11570812 GCAGAGTCCCTGGCACATTCAGG + Intronic
1078851539 11:15168579-15168601 GCACACTGCATGGCACAAAAGGG - Intronic
1079938956 11:26653670-26653692 GCAGAGACCTTGGCACGTACTGG - Intronic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1081948691 11:47022811-47022833 GTAAAATGCTTGGCACATTCGGG - Intronic
1083407112 11:62465151-62465173 AGAGACTGCTTGGCACCAACTGG - Intronic
1083552560 11:63600917-63600939 GCAGAATGGTTGCCACATTCAGG - Intronic
1085137190 11:74102318-74102340 ACACATTGCCTGGCACATACTGG - Intronic
1085149753 11:74240851-74240873 GCATAGTGCTTAGCACATAATGG - Intronic
1085226011 11:74921825-74921847 GCACAGTGCTTGGCACACAGTGG + Intronic
1085653128 11:78286541-78286563 GCAGAGTGCTTAACACATATAGG + Intronic
1085839141 11:79990542-79990564 GCACAATGCTTGGCACAGAGTGG - Intergenic
1087084239 11:94200225-94200247 GCAGAGTGCCTGGTACCTACGGG + Intergenic
1089040439 11:115443724-115443746 GCAGACTGCTTGGCACATACTGG - Intronic
1089408309 11:118217193-118217215 GCAAAATGCCTGGCATATACTGG + Intronic
1090073850 11:123566833-123566855 GCAAAATGACTGGCACATACTGG - Intronic
1090210659 11:124919273-124919295 GCAGAGTGCCTAGCACATACTGG - Exonic
1090470580 11:126977621-126977643 GCACAATGCCTGGCACATAGTGG + Intronic
1095510713 12:42949026-42949048 GCACAATGCTTGGCAGATAAGGG + Intergenic
1095598967 12:43993329-43993351 GCACAGTGCCTGGCACATAATGG + Intronic
1097585478 12:61510658-61510680 ACACAGTGCTTGGCACATATGGG + Intergenic
1098124114 12:67272152-67272174 GCAGAGTGCTTTGCACATGTTGG - Intronic
1098286708 12:68914371-68914393 GCACAGTGCATGGCACATAAAGG + Intronic
1098646276 12:72905375-72905397 GAAGAGTGCCTGGCACATAGGGG + Intergenic
1099569858 12:84303452-84303474 GCAGAGTGTCTGGCACATAATGG - Intergenic
1101888617 12:108691514-108691536 TCAGCCTGCTTAGCACAGACTGG + Intronic
1103105469 12:118220726-118220748 GCAGAGTGCTTGCTACTTACAGG - Intronic
1104946766 12:132418141-132418163 GAAGGCTGCCTGGCACTTACAGG + Intergenic
1106548916 13:30754744-30754766 GCATAGTGCCTGGCACATAGGGG - Intronic
1106722438 13:32449670-32449692 GCACAATGCTTGACACATAGTGG + Intronic
1108497927 13:51043404-51043426 GCAACATGCATGGCACATACTGG - Intergenic
1108501390 13:51072675-51072697 GAAGAGTGCTTGGCAAATACGGG + Intergenic
1109245731 13:59952872-59952894 GAAGAATGCTTGGCACATATGGG - Intronic
1109248805 13:59992453-59992475 GGAGACTGCAGGGCACTTACTGG + Exonic
1110873316 13:80478822-80478844 GCAAAATGCCTGGCACATAATGG - Intergenic
1111968634 13:94886895-94886917 GCACATTGCCTGGCACATAGGGG + Intergenic
1112133122 13:96545956-96545978 GCACAGTGCCTGGCACATAGTGG + Intronic
1112437921 13:99404767-99404789 GCAAACTACTGGGCACCTACAGG + Intergenic
1112727321 13:102319424-102319446 GCAGGAGGCTTGGCACTTACAGG - Intronic
1113074245 13:106452274-106452296 GCATACTGCTTGGCAAATGATGG - Intergenic
1114409105 14:22484188-22484210 GCAGACAGCTTGGAACGTTCTGG + Intergenic
1115144707 14:30212916-30212938 GCAAACTGCCTGGCACGTAGAGG - Intergenic
1115438275 14:33402072-33402094 ACAGACTGCATGGCAGATAGTGG - Intronic
1115520807 14:34231363-34231385 GCACAGTGCTGGGCACATAATGG + Intronic
1116041231 14:39688335-39688357 GAATACTGCTTGCCACATAATGG + Intergenic
1116784976 14:49277706-49277728 GGAAACTGCTTGGCACATAGTGG - Intergenic
1116951118 14:50879439-50879461 GCACAATGTTTGGCACATAAAGG + Intronic
1117789807 14:59328515-59328537 GCACAGTGCCTGACACATACAGG - Intronic
1120989613 14:90363585-90363607 GCCTAGTGCATGGCACATACTGG + Intergenic
1121837214 14:97102698-97102720 GCAGAATGCTTGGCAAAGAGGGG - Intergenic
1122253141 14:100454672-100454694 GCAGCCTGTCTGGCACAGACTGG - Intronic
1125100403 15:35905927-35905949 GCAGACTGCCTGGCATATAGTGG + Intergenic
1125826946 15:42684626-42684648 GCAGACTGCTGGGCACGGAAAGG + Exonic
1127065946 15:55238566-55238588 GCACAATGGTTGGCATATACTGG + Intronic
1129693748 15:77728876-77728898 GCACAGTGCCTGGCACATAGCGG + Intronic
1131443154 15:92473960-92473982 GCATCCTTCTTTGCACATACCGG + Intronic
1133861909 16:9603999-9604021 GAACACTGCTTAGCACATATAGG - Intergenic
1133893069 16:9900067-9900089 GCAGAGTGCTTGGCACATTATGG + Intronic
1134449853 16:14356590-14356612 GCAGACAACTTGGAACATAACGG + Intergenic
1134617827 16:15665217-15665239 TCACACTGCCTGGCACATATAGG - Intronic
1135429631 16:22372424-22372446 GCATAATACTTGGCACATACTGG - Intronic
1137054469 16:35736802-35736824 CCAGACTTCTTGGCTCCTACAGG + Intergenic
1137708755 16:50552211-50552233 GCAAAGTGCTTGACACATATAGG - Intronic
1138016072 16:53429896-53429918 GCAGAATTCTTGGCACATAAAGG + Intergenic
1138735364 16:59244684-59244706 GTAAACTGCTTGGTACATTCAGG + Intergenic
1139740493 16:69031298-69031320 TCACAGTGCTTGGCACATAGTGG + Intronic
1141217583 16:82039510-82039532 GGAAAATGCATGGCACATACTGG - Intronic
1141326115 16:83060990-83061012 GCAGAGGGCCTGGCACATAGTGG + Intronic
1142976532 17:3648027-3648049 GCAGCCTCCCTGGCACAGACTGG - Intronic
1143948393 17:10614260-10614282 GAACAGTGCTTGGCACATAGAGG + Intergenic
1144438900 17:15263830-15263852 GCAAAGTGCTTGGCATATAACGG - Intronic
1146699202 17:34939639-34939661 GTAGATTGCTTGGGACATGCTGG - Exonic
1146702743 17:34975650-34975672 GCAAACTGCTTGGCACTTAGAGG - Intronic
1147534232 17:41308315-41308337 GCAGATGGGTTGGCAGATACTGG + Exonic
1147534256 17:41308510-41308532 GCAGACAGCCTGGCAGCTACTGG + Exonic
1148834550 17:50459004-50459026 GCATAGTACTTGGCACATACGGG + Intronic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1149469207 17:56902327-56902349 GCAGAGTGCTTGGCATATAGTGG - Intronic
1150526594 17:65929710-65929732 TCACAGTGCCTGGCACATACAGG + Intronic
1155082375 18:22423544-22423566 GAACGCTGCTTGGCACATATGGG - Intergenic
1157661182 18:49446617-49446639 GCATACTGCTGGCCACATAGTGG - Intronic
1158028999 18:52939591-52939613 GCAAAGTGCCTGGCACATAATGG - Intronic
1158054726 18:53265016-53265038 GCTCACTTCTGGGCACATACTGG - Intronic
1158131017 18:54152748-54152770 GCACAGTGCCTGGCACATAGTGG - Exonic
1158180965 18:54714450-54714472 TCAGTCTGCTTGGCTCACACAGG - Intergenic
1158867325 18:61650396-61650418 GCAGGGTGCCTGGCACATAGAGG + Intergenic
1163410779 19:17152945-17152967 GCAGACATCTGAGCACATACTGG - Intronic
1165726051 19:38113707-38113729 GCACAGAGCTTGGCACATAGTGG + Intronic
925404934 2:3599826-3599848 GCAGACTGCATGCCACTGACGGG - Intronic
926356494 2:12045502-12045524 GCACAGGGCCTGGCACATACTGG - Intergenic
926372315 2:12191978-12192000 GCAAAATGCCTGGCACATAGTGG - Intergenic
926979450 2:18552374-18552396 GCAAAGTGTCTGGCACATACAGG - Intergenic
927605386 2:24482285-24482307 GAATAATGCTTGGCCCATACTGG + Intergenic
928216661 2:29367152-29367174 GCACAGAGCCTGGCACATACTGG - Intronic
928943269 2:36749496-36749518 GTAAAGTGCTTGGCACATACAGG - Intronic
931194982 2:60043192-60043214 GCACACTGCTGGGCCCATCCTGG + Intergenic
934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG + Intronic
935658276 2:105443460-105443482 GCACAATGCTTGGCACATGGAGG - Intergenic
936500902 2:113065503-113065525 GCATAATGCTTGGCACATAATGG + Intergenic
936980509 2:118260820-118260842 GCAGAATGCTTGGCATATAACGG - Intergenic
937299470 2:120830335-120830357 GCATAGTGCCTGGCACATAGGGG + Intronic
940623614 2:156145310-156145332 GGAGAATGCTTGGCACATAGAGG - Intergenic
940996539 2:160156281-160156303 GCAGACTCCTTGGCTCTCACAGG + Intronic
941460149 2:165761088-165761110 GCAGACTCCTTGGCATAAAAAGG - Intronic
941884180 2:170511702-170511724 GCAGACTGTTCTGCACAGACAGG - Intronic
942255296 2:174091075-174091097 GCACAATGCCTGGCACATAGTGG + Intronic
942947838 2:181688745-181688767 GCACAGTGCCTGGCACATAATGG - Intergenic
943613082 2:190057900-190057922 CCAGATTGCCTGGCACATAATGG + Intronic
946531682 2:220577465-220577487 GCAGAGTGCTCAGCACATATGGG + Intergenic
947367400 2:229411031-229411053 GCAGACTGAGTGACACACACAGG - Intronic
947370628 2:229441876-229441898 GGAGCTTGCTTGGCACTTACAGG - Intronic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
948278979 2:236731916-236731938 GCAGACTGCTTTGCCTATTCAGG + Intergenic
1169087212 20:2834935-2834957 GCATAATTCTTGGCACATAGTGG - Intergenic
1170042640 20:12054140-12054162 GGAGAGTGTCTGGCACATACTGG + Intergenic
1171968465 20:31548576-31548598 GCACAGTGCCTGGCACATAGTGG - Intronic
1172164515 20:32890884-32890906 GCATAGTGCCTGGCACATAGTGG + Intronic
1172776871 20:37412960-37412982 CCTGACAGCTTGTCACATACTGG - Intergenic
1173932000 20:46828451-46828473 GCACACTGCTTGGCAGTCACAGG - Intergenic
1174361343 20:50030594-50030616 GAAGACTGCCTGGCACACAGGGG - Intergenic
1175496511 20:59418240-59418262 GCACAGTGCTTGGCATATAGTGG - Intergenic
1176234045 20:64045926-64045948 GCAGACTGCTTGGAAGACATGGG + Intronic
1178987703 21:37322359-37322381 ACAGATTGCCTGGGACATACTGG - Intergenic
1179985369 21:44918021-44918043 CCATTCTGCTTGGCACAAACTGG - Intronic
1180688422 22:17689057-17689079 GAAGACTGCTTGGCCCATCTTGG + Exonic
1181898362 22:26131138-26131160 GCACAGTGCCTGGCACATAAAGG + Intergenic
1182048684 22:27297015-27297037 GCATAATGCTAGGCACATAGTGG - Intergenic
1183342210 22:37287660-37287682 CCAAACTGCTTGGGACATGCAGG - Intronic
1183722731 22:39571872-39571894 GCACAGTGCTTGGCACATCGTGG + Intronic
1183788774 22:40047846-40047868 GCACAGTGCTTGGCACATAGTGG + Intronic
1183947284 22:41333716-41333738 GCTCAGTGCTTGGCCCATACTGG - Intronic
1184287959 22:43482650-43482672 GCACACTGCTTGGCACATGGTGG + Intronic
949650398 3:6151602-6151624 GCACAGTGCTGGGCACATAGTGG + Intergenic
949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG + Intronic
949982318 3:9509464-9509486 GCACAGTGCCTGGCACATAGTGG - Intronic
951882089 3:27489380-27489402 CCAGAGTGCCTGGCACATAGTGG + Intergenic
952666110 3:35906271-35906293 GCACAGTGCTTGGCACATGGAGG + Intergenic
953156521 3:40380125-40380147 GCACAGTGCCTGGCACATAGAGG + Intergenic
953564684 3:44021568-44021590 GGAGACTGCCAGGCACATTCTGG + Intergenic
954806381 3:53223357-53223379 GAACACTGCTAGGCAGATACGGG - Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
956152828 3:66261196-66261218 GCAGACTGCTAGGTGCATAGCGG + Intronic
956906002 3:73766060-73766082 GCACAGAGCTTGGCACACACAGG - Intergenic
960688989 3:120323729-120323751 GATGACTGCTTGGCAAAGACAGG - Intergenic
961187982 3:124932644-124932666 GGATACTGCCTGGCACATAGGGG - Intronic
961547607 3:127646102-127646124 ACATAGTGCTGGGCACATACTGG - Intronic
962907114 3:139814017-139814039 GCACAATCCTTGGCACATATAGG + Intergenic
963227532 3:142877519-142877541 GCACAGTGCTTGGCACAAGCAGG - Intronic
963252219 3:143114111-143114133 TCAGATTGCTTGGCACATGGTGG + Intergenic
964502996 3:157369014-157369036 GCACAGTGCTTGGCACACACAGG + Intronic
968980438 4:3846124-3846146 GCCCACTGCTTGGCACATATTGG - Intergenic
969993504 4:11288702-11288724 GCAAAATGCTTGGCCCAAACAGG - Intergenic
970239217 4:13990676-13990698 GCAGAGTGCCTGACAGATACTGG + Intergenic
970372603 4:15423344-15423366 GCACAGTGCCTGGCACACACAGG + Intronic
970770371 4:19605571-19605593 GCAGACTGCATGTCACCTTCAGG + Intergenic
970844706 4:20522828-20522850 CCAGACTGCCCAGCACATACTGG - Intronic
971112758 4:23607453-23607475 GCAAAATGCTTGGTACATAATGG - Intergenic
971929228 4:33057852-33057874 CCAGACTGCTTGGCACTGGCAGG - Intergenic
972900820 4:43681025-43681047 GCAGACTGTGTTGCACATATTGG + Intergenic
973325075 4:48852148-48852170 GCAGAGTCCTTGACACCTACTGG - Intronic
973812359 4:54583923-54583945 GCACAGTGCTTGGCACACAGTGG + Intergenic
974185245 4:58437085-58437107 TAAGAGTGCTTGGCACAAACTGG + Intergenic
975194936 4:71513211-71513233 GCAGACTGCTTTGTACATTATGG + Intronic
976038394 4:80852906-80852928 GCACAGTGCCTGGTACATACTGG - Intronic
980997140 4:139790125-139790147 GCAGACGGCTTGGGAGAAACAGG + Intronic
981582745 4:146266948-146266970 GAAGAGTGCCTGGCACATAATGG - Intronic
986412136 5:7491946-7491968 ACAGACAGCCTGGCACACACAGG - Intronic
987105988 5:14639977-14639999 CCTGACTGCTTGGGACATGCAGG - Intergenic
988114596 5:26868266-26868288 ACATACTGCTTGGCTCACACTGG + Intergenic
988644035 5:33073987-33074009 GCAGACTGCATGGCAAGTGCTGG - Intergenic
989790718 5:45397084-45397106 GCAGACAGTATGACACATACAGG + Intronic
990030083 5:51248102-51248124 GAAGAATGTTTGGCATATACTGG - Intergenic
991632943 5:68674983-68675005 GCACAGTGCCTGGCACATAGTGG + Intergenic
992668609 5:79036160-79036182 GTATACTGCATGGCACATAGTGG + Intronic
993774316 5:91972023-91972045 GCAGGCTACTTGGCACATAGTGG - Intergenic
995251664 5:110000293-110000315 GCAGAGCGCCTAGCACATACTGG + Intergenic
996819377 5:127609212-127609234 GGGGACTGCTTGGCACCTCCAGG + Intergenic
998599454 5:143570210-143570232 GCACAGTGCTTGACACATAGGGG + Intergenic
999696023 5:154189825-154189847 GCACAGTGTTTGGCACATAGTGG + Intronic
1000171675 5:158708398-158708420 GCACACTGCCTGGCACACAGTGG - Intronic
1000365444 5:160486486-160486508 GCACAGTGCTTGGCACATAGTGG - Intergenic
1001032893 5:168275741-168275763 GCAGCCTGTTTGGGACACACTGG + Intergenic
1001133072 5:169080339-169080361 GCACAGTGCTTGGCACATAAAGG - Intronic
1001220910 5:169900095-169900117 GCACAATGTTTGGCACATAGTGG - Intronic
1001917543 5:175574309-175574331 GCATAGTGCTTGGCATGTACTGG + Intergenic
1003186565 6:3836799-3836821 TCAGGCTCCTTGGCACATTCTGG - Intergenic
1003430755 6:6035384-6035406 GCACAGTGCTTGGCACAAAGAGG + Intergenic
1003740671 6:8935031-8935053 GCAAAATGCCTGGCACATAGTGG - Intergenic
1005488202 6:26321180-26321202 CCAGACTGCTTTCCACATGCAGG - Intergenic
1006952671 6:37837202-37837224 ACAGACTTCTTGGCTGATACTGG + Intronic
1007050547 6:38824233-38824255 GCAGACTGCTAGTCTCATACAGG + Intronic
1007585826 6:42988737-42988759 GCAGACTGCTTGGCACTGACAGG - Intronic
1008014751 6:46505845-46505867 GCTTAGTGCCTGGCACATACAGG + Intergenic
1008684942 6:53914945-53914967 TCAGAGTGCCTGGCACATAATGG + Intronic
1010253857 6:73735852-73735874 GCAGAGTGCCTGACACATATTGG + Intronic
1010366625 6:75058996-75059018 GCAGACTTCTCTGGACATACAGG + Intergenic
1011719965 6:90145148-90145170 GCATACTGCCTGACACATAGTGG + Intronic
1012414816 6:99001839-99001861 GCACAATGCCTGGCACATAGTGG - Intergenic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1013978537 6:116103166-116103188 GCTTAGTGCTGGGCACATACTGG + Intronic
1015372596 6:132471976-132471998 GCTGACTGCGTGGAACATGCAGG - Intronic
1015402702 6:132804499-132804521 GCAGACTGTTAGACTCATACAGG + Intergenic
1015449612 6:133350197-133350219 GAACACTGCATGGCACATAATGG - Intronic
1015570454 6:134616053-134616075 GCACAGTGCCTGGCACATAGTGG - Intergenic
1016902397 6:149115298-149115320 GGACACTGCCTGGCACATCCTGG + Intergenic
1017662782 6:156690190-156690212 CCAAAGTGCTTGGCACATCCTGG + Intergenic
1017950156 6:159129350-159129372 GGTGACTGCTGGGCACATACGGG + Intergenic
1018673998 6:166203270-166203292 GCAGAAAACTTGGCACATAGTGG + Intergenic
1020185970 7:5960016-5960038 GCAGATTGCTTGAGACATATTGG - Intronic
1020296947 7:6764746-6764768 GCAGATTGCTTGAGACATATTGG + Intronic
1023083453 7:36546891-36546913 GCACAGTGCTTGGCACATCGTGG + Intronic
1023705242 7:42933721-42933743 GCACATTGCTTGGCATATAGTGG - Intronic
1025090540 7:56059596-56059618 CCTGACTGCTTGGGACATGCAGG + Exonic
1025832916 7:65069713-65069735 CCTGACTGCTTGGGACATGCAGG + Intergenic
1025854314 7:65264600-65264622 GCTGACTGCTTTGCACACACGGG - Intergenic
1027545663 7:79524517-79524539 GCAGACTGCTGGGAACATGGTGG + Intergenic
1028492333 7:91425910-91425932 ACATAATGCTTGGCACATAGTGG - Intergenic
1028615816 7:92765668-92765690 GCATACTGCCTGGAACATAGGGG - Intronic
1028982052 7:96978126-96978148 GCCCAGTGCTGGGCACATACAGG - Intergenic
1029923413 7:104290432-104290454 GCACAATGCTTGGCACATAATGG - Intergenic
1030082414 7:105789281-105789303 GCACAGTGCCTGGCACATTCAGG - Intronic
1032470233 7:132173021-132173043 GTAGAGTGCCTGGCACATAATGG - Intronic
1033454732 7:141492489-141492511 GCACAATGCCTGGCACATACTGG + Intergenic
1033720073 7:144049915-144049937 GCAGAGTGCATTGCACATGCAGG - Intergenic
1034259182 7:149743912-149743934 GCATAGTGCCTGGCACATTCTGG - Intergenic
1035144192 7:156796932-156796954 GAATAGTGCTTGGCACATAAGGG - Intronic
1035651746 8:1271356-1271378 GCACAATGCATGGCACACACTGG + Intergenic
1036062675 8:5341919-5341941 GCACAATGCATGGCACATACAGG - Intergenic
1038332251 8:26618225-26618247 GCAAAATGCCTGGCACACACTGG - Intronic
1040720533 8:50316809-50316831 GCACAGTGCTTGGGACATAGTGG - Intronic
1041413660 8:57583817-57583839 GAAGGATGTTTGGCACATACTGG - Intergenic
1041914428 8:63125733-63125755 GGACACTGCCTGGCACATAAGGG + Intergenic
1042618764 8:70679851-70679873 GCTCAGTGCTTGGCACATAGTGG + Intronic
1043427229 8:80159535-80159557 GCACACAGCTTGGCGCAGACAGG - Intronic
1045378073 8:101595135-101595157 GGACACTGCCTGGCACATAGAGG + Intronic
1047605264 8:126468170-126468192 GCAGATTGCCTGGCCCATAGCGG + Intergenic
1047852535 8:128874109-128874131 GCACTGTGCTTGGCACATAACGG - Intergenic
1047864890 8:129012207-129012229 TCATAATGCTAGGCACATACTGG + Intergenic
1049052140 8:140206918-140206940 GCAGACTGTCTGGCACATGACGG - Intronic
1049216582 8:141411081-141411103 GGAGGCTGCTAGGCACACACAGG - Intronic
1051801765 9:20942685-20942707 GTATACTGCTTGGCGTATACAGG - Intronic
1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG + Intergenic
1052345073 9:27401146-27401168 GCAGACCGCGTGGCCCATGCTGG - Intronic
1052787349 9:32841653-32841675 ACACAGTGCCTGGCACATACAGG + Intergenic
1054974909 9:71131484-71131506 GCAGACTGTCTGGAACATAATGG + Intronic
1055768599 9:79691992-79692014 GCAGAATGCCTGGCAAATAGTGG + Intronic
1056779981 9:89541990-89542012 GCAGGCTGCTTGTCACCCACAGG + Intergenic
1058008955 9:99953278-99953300 GCACAATGCTTGGCACATAATGG + Intronic
1058239615 9:102540619-102540641 GCAGACCTCTTGGCAGATGCTGG - Intergenic
1060159728 9:121350469-121350491 GCAGAGTGCTTGAAACATAGCGG + Intronic
1060317138 9:122522731-122522753 GCACACTGCCTGGCACAGACAGG - Intergenic
1060547976 9:124471749-124471771 GCACAGTGCCTGGCACACACTGG - Intronic
1060901607 9:127262793-127262815 GCCTACTGCCTGGCACATAGTGG - Intronic
1060986011 9:127819410-127819432 TCAGAGGGCTTAGCACATACTGG - Intronic
1186633519 X:11377205-11377227 GCATAGTGCTTGGCACAAAATGG + Intronic
1188553556 X:31386632-31386654 ACACAGTGCTTGGCACATAATGG + Intronic
1189131708 X:38505624-38505646 GCACAGTGCTTGCCACATAGTGG + Intronic
1189193218 X:39129541-39129563 GCATAGTGCTTGGCACATAATGG + Intergenic
1191841828 X:65518752-65518774 GCACAGTGCCTGGCACATAGTGG + Intronic
1195710101 X:107766744-107766766 GCAGACTGCTTGCCTGACACTGG + Intronic
1196306855 X:114113018-114113040 GCACTGTGCTTGGAACATACTGG + Intergenic
1197122382 X:122907206-122907228 CCCGACTGCTTGTCACAGACAGG + Intergenic
1197314996 X:124954746-124954768 GCAGAGTACTTGGCACATAGTGG + Intronic
1198405115 X:136304684-136304706 GCATGCTGCCTGGCACATAGAGG - Intronic
1198511471 X:137356146-137356168 GCAAAGTGCCTGGCACATAGTGG + Intergenic
1199728508 X:150607762-150607784 GCATAGTGCTTAACACATACTGG - Intronic
1199890565 X:152075016-152075038 GCAGAGTGCTTTGCTCATAGTGG - Intergenic
1200793432 Y:7319085-7319107 GGACATTGCTTGGCACATAAGGG + Intergenic
1201687107 Y:16717416-16717438 CAAGACTGCTTGGCAGATATTGG + Intergenic