ID: 1089041992

View in Genome Browser
Species Human (GRCh38)
Location 11:115460805-115460827
Sequence CACTTATATCAACTGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089041989_1089041992 18 Left 1089041989 11:115460764-115460786 CCTATGCACTAGAAAGAAAGAAA 0: 1
1: 0
2: 7
3: 80
4: 698
Right 1089041992 11:115460805-115460827 CACTTATATCAACTGGACACTGG 0: 1
1: 0
2: 0
3: 8
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089041992 Original CRISPR CACTTATATCAACTGGACAC TGG Intronic
902731994 1:18375795-18375817 CAGTTAACTCAACTGGACAATGG + Intronic
907591802 1:55681017-55681039 CAATGAGATCACCTGGACACAGG - Intergenic
908451328 1:64258515-64258537 CAATGAGAACAACTGGACACGGG - Intronic
909414345 1:75388008-75388030 CAATGAGATCACCTGGACACAGG + Intronic
910257845 1:85266511-85266533 CAGTTATTTCAACTGTACATTGG + Exonic
913525768 1:119691289-119691311 CAATGAGATCACCTGGACACAGG - Intronic
918562557 1:185887501-185887523 CAATGATATCACATGGACACAGG - Intronic
918702920 1:187627857-187627879 CACTTGTATAAATTGGAAACTGG - Intergenic
919240376 1:194907613-194907635 CAATGAGATCACCTGGACACAGG + Intergenic
923064027 1:230501536-230501558 CACTTATTTCAGGTTGACACAGG - Intergenic
924714145 1:246556903-246556925 CATTTACCTCACCTGGACACAGG - Intronic
1063625652 10:7687443-7687465 CACTTCCATCAGCTGGAAACAGG + Intergenic
1065657823 10:27970271-27970293 GACCTATATAAAGTGGACACTGG - Intronic
1068813948 10:61288533-61288555 CAGTTAGTTGAACTGGACACTGG - Intergenic
1069260449 10:66387892-66387914 CAATGAGATCACCTGGACACAGG + Intronic
1070062283 10:72995818-72995840 CAATGAGATCACCTGGACACAGG + Intergenic
1071825512 10:89322016-89322038 CAATAAGAACAACTGGACACAGG + Intronic
1071891736 10:90015382-90015404 CACTGAGATCACATGGACACAGG + Intergenic
1074025576 10:109630300-109630322 CAATGAGAACAACTGGACACAGG - Intergenic
1076095260 10:127729441-127729463 CAATGAGATCAAATGGACACAGG - Intergenic
1077943465 11:6869708-6869730 CACTTATAGCTACAGGAAACTGG + Exonic
1078684023 11:13510033-13510055 CAATGATATCACATGGACACAGG + Intergenic
1082723666 11:56709606-56709628 CAATTAGATCACTTGGACACTGG - Intergenic
1087833045 11:102840447-102840469 CATTTATATCATCTTGAGACAGG + Exonic
1087880973 11:103416097-103416119 CATTGAAATCACCTGGACACAGG + Intronic
1089041992 11:115460805-115460827 CACTTATATCAACTGGACACTGG + Intronic
1093467771 12:19467669-19467691 GACTTATATTAAGAGGACACTGG - Intronic
1093683413 12:22029619-22029641 CACTTGTATCATCTTGACAATGG + Intergenic
1095935783 12:47679195-47679217 CAATGAGATCACCTGGACACAGG + Intronic
1096821865 12:54242600-54242622 CACTTAGATGATCTGGAAACTGG - Intronic
1098570760 12:71985021-71985043 ACTATATATCAACTGGACACAGG + Intronic
1098594881 12:72260474-72260496 CACTGGGAGCAACTGGACACGGG + Intronic
1099892256 12:88604215-88604237 AACTTGTATCAACTGAACAAGGG - Intergenic
1101057442 12:100933313-100933335 CAATGATATCACCTGGACACAGG - Intronic
1103195852 12:119043336-119043358 CAATTAGAACACCTGGACACAGG + Intronic
1103688423 12:122751350-122751372 CTCTTATCTCAACTGCACAGAGG + Intergenic
1104653086 12:130551637-130551659 CAATTCTATAAATTGGACACAGG - Intronic
1109279624 13:60340972-60340994 CAATAAGATCACCTGGACACAGG - Intergenic
1109389749 13:61677899-61677921 CAATTAGAACAAATGGACACAGG - Intergenic
1110071805 13:71187074-71187096 CAATGAAATCACCTGGACACAGG + Intergenic
1110861856 13:80353275-80353297 CACTCATACCAACTGGATTCTGG + Intergenic
1112075995 13:95914030-95914052 CAATGAGATCAATTGGACACAGG + Intronic
1115000536 14:28415924-28415946 CTCTTATCTCAACTGGAAAGAGG - Intergenic
1115158760 14:30369352-30369374 CAATGAGATCACCTGGACACAGG + Intergenic
1115168832 14:30479847-30479869 CAATGAGATCACCTGGACACAGG + Intergenic
1116690338 14:48098343-48098365 CAATGATATCATATGGACACAGG - Intergenic
1122467157 14:101941623-101941645 CAATGAGAACAACTGGACACAGG - Intergenic
1126934391 15:53690013-53690035 CAATTAGATCACATGGACACAGG + Intronic
1128810284 15:70566435-70566457 CCCTTATATCATCTGGTCACAGG + Intergenic
1129132061 15:73508638-73508660 CAATGAGATCACCTGGACACAGG - Intronic
1132411731 15:101583909-101583931 CAATTAGAACACCTGGACACAGG - Intergenic
1134486163 16:14660150-14660172 CAGTGATCTCCACTGGACACTGG + Intronic
1137064225 16:35821774-35821796 CATTTATAATAACTGTACACTGG + Intergenic
1139268561 16:65661568-65661590 CACTTAGATCAACTTGTCAGTGG + Intergenic
1148521413 17:48279547-48279569 CACATGTATCATTTGGACACAGG - Intronic
1152086595 17:78223339-78223361 CACCTAAATAAACTGGGCACTGG - Intronic
1155779052 18:29808005-29808027 CACTTATTTCAAGTGGAATCTGG + Intergenic
1156503033 18:37571612-37571634 CTCTTCTATCAAGTGGAGACTGG + Intergenic
1158231023 18:55255372-55255394 CACTTGAATCAACTGTTCACTGG + Intronic
1158431761 18:57394805-57394827 CAATGAGATCAGCTGGACACAGG - Intergenic
1159648641 18:70951098-70951120 CACTTATATGAGTTGGAAACAGG + Intergenic
1160008856 18:75088776-75088798 CGCTCAGAGCAACTGGACACCGG - Intergenic
1164094036 19:21988928-21988950 CATATTTATCAACTGGACATGGG + Intronic
1164176253 19:22777856-22777878 CAAGCATATCCACTGGACACTGG - Intronic
1164179997 19:22810051-22810073 CACTTATATCAACTAGGTGCTGG - Intergenic
1164214524 19:23133015-23133037 TACTAATATCAACTGGACTAAGG - Intronic
1164358136 19:27466192-27466214 CAATTAGATCACATGGACACAGG + Intergenic
1165780330 19:38429678-38429700 CACTTGTTTCTACTGTACACAGG + Intergenic
1167328913 19:48842074-48842096 CATTTATATAAACAGGACTCAGG - Intronic
1167734152 19:51281647-51281669 CAGTTTTATCACCTGGACGCTGG + Intergenic
1168010189 19:53523957-53523979 CAATGAGATCAATTGGACACAGG - Intronic
929248465 2:39727760-39727782 CAGTTAGATCACTTGGACACAGG - Intergenic
931425459 2:62167039-62167061 CCCTTATATCAAAAGGATACAGG + Intergenic
932134588 2:69217279-69217301 CACTTGTGTGAGCTGGACACTGG - Intronic
937400954 2:121583121-121583143 CCCTTATAGTAACTGGGCACTGG - Intronic
941091176 2:161177846-161177868 CATTTATTACAAGTGGACACAGG + Intronic
943187678 2:184633460-184633482 TACTTAAATAAACTGGACAAAGG + Intronic
944393659 2:199245803-199245825 CAATTATATCACTGGGACACTGG - Intergenic
946197053 2:218039792-218039814 CATTTAAATCAACTGGTCATTGG + Intronic
946971812 2:225101905-225101927 CAATGAGATCACCTGGACACAGG + Intergenic
1169981081 20:11384521-11384543 CAGTTATAACAACTGGACTAGGG - Intergenic
1170028885 20:11923288-11923310 CTCTTTTATCAACTGCAAACTGG - Exonic
1175043772 20:56082245-56082267 CACTGAGATCACATGGACACAGG - Intergenic
1184586916 22:45454140-45454162 CATTTATATCAACTGGATTGAGG - Intergenic
953506317 3:43489117-43489139 CAATGAGATCACCTGGACACAGG + Intronic
957815831 3:85295724-85295746 CAATTAGATCACATGGACACAGG + Intronic
958046102 3:88285522-88285544 CAATGAGATCAATTGGACACAGG - Intergenic
959250399 3:103934419-103934441 CAATGAGAACAACTGGACACAGG + Intergenic
960558043 3:119050943-119050965 CAATGATATCACATGGACACAGG + Intronic
962437442 3:135380104-135380126 CATTTGCATCAACTGGTCACTGG - Intergenic
964654972 3:159056179-159056201 CAATGAGATCAAATGGACACAGG - Intronic
966511077 3:180764147-180764169 GGGTTATGTCAACTGGACACAGG + Intronic
969037483 4:4266439-4266461 CACTTTTCTCAGCTGGACAATGG - Intergenic
969692791 4:8713778-8713800 CAATTATATCACATGGACACAGG + Intergenic
971800189 4:31279231-31279253 CAATTACATCAAAAGGACACAGG + Intergenic
975141651 4:70924676-70924698 CAATGAGATCAACTGGACACAGG - Intronic
975348944 4:73325111-73325133 CAATGAGAACAACTGGACACAGG + Intergenic
978329486 4:107597341-107597363 CAATGATATCACTTGGACACAGG + Intronic
979784177 4:124694515-124694537 CACTTCTAGCAACAGGACTCAGG + Intronic
979898605 4:126190538-126190560 CCCTTAAATCAAGGGGACACTGG - Intergenic
981239011 4:142452097-142452119 CAATGAGATCACCTGGACACAGG - Intronic
981496863 4:145403577-145403599 CAATGAGATCACCTGGACACAGG + Intergenic
982437395 4:155394804-155394826 CAATAATATCACTTGGACACAGG - Intergenic
982652007 4:158098292-158098314 CAATGAGAACAACTGGACACAGG + Intergenic
984193411 4:176631058-176631080 CAATTATAACACATGGACACAGG + Intergenic
987779278 5:22412292-22412314 GACTTATAGCAGATGGACACAGG - Intronic
988630574 5:32926993-32927015 CAATTAGATCACATGGACACAGG + Intergenic
989864079 5:46424564-46424586 CAATGAGATCACCTGGACACAGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
993006076 5:82429595-82429617 CAATGATATCACATGGACACAGG - Intergenic
993501246 5:88669867-88669889 TAGTCATATCAACTGGACTCCGG + Intergenic
993658391 5:90600348-90600370 CAATGAGAACAACTGGACACAGG - Intronic
994122896 5:96136317-96136339 CAATTATGTCAAATGGGCACAGG - Intergenic
995420480 5:111961294-111961316 GACTTAAATCCACTGGGCACTGG - Intronic
997391496 5:133520700-133520722 CACATATATCATCCAGACACAGG + Intronic
998911376 5:146964047-146964069 CCCTTAAGTCAGCTGGACACTGG + Intronic
999560932 5:152801973-152801995 CACTTTTATCAAAGGGTCACTGG - Intergenic
999942346 5:156557498-156557520 TACTTATATTAACAGGTCACAGG - Intronic
1001592168 5:172873188-172873210 CATTTATAGCATCTGCACACAGG + Intronic
1005823973 6:29621187-29621209 CCCTTCTATCAACTGCACAGTGG - Exonic
1008892304 6:56508888-56508910 CACTGATATCCACTGGACTGGGG - Intronic
1009508290 6:64514571-64514593 CCCTTATAACAGCTGGACACAGG - Intronic
1012481530 6:99672718-99672740 CAATTATGTCAACTGCAAACAGG + Intergenic
1012910456 6:105112074-105112096 CACTGGTATCACCTGGGCACTGG + Intronic
1013526399 6:110978191-110978213 CACTTCTATAATCTGAACACTGG + Intergenic
1013756847 6:113471854-113471876 CAATGATATCACTTGGACACAGG - Intergenic
1015155544 6:130091361-130091383 CAGTTATATCAACTGATCACAGG - Intronic
1016436487 6:144043102-144043124 CAATCATATCATCTGGAAACAGG + Intronic
1021042616 7:15881868-15881890 CAATTATAACACATGGACACAGG - Intergenic
1021307702 7:19051674-19051696 CAATTAGAACACCTGGACACAGG + Intronic
1021340349 7:19456856-19456878 CACAAATATCATCAGGACACAGG - Intergenic
1023308850 7:38861428-38861450 CTCTTCTACCCACTGGACACTGG - Intronic
1025161700 7:56666985-56667007 CAGTTATATCATCTGGAAGCTGG - Intergenic
1027947229 7:84763302-84763324 CATTTACATCAACTGAACTCGGG + Intergenic
1029648168 7:101871410-101871432 CTCTTCTACCAACAGGACACAGG - Intronic
1030493326 7:110266087-110266109 CAATGAGATCAAATGGACACAGG - Intergenic
1033485762 7:141787562-141787584 CACTTACATCTACCTGACACTGG - Intronic
1034986340 7:155517734-155517756 CACTTTTATCCACTGGCCATGGG + Intronic
1035085057 7:156251165-156251187 CACATATAACAACTGGAAAACGG + Intergenic
1035798022 8:2377086-2377108 CAATGAGATCACCTGGACACAGG + Intergenic
1036160960 8:6388154-6388176 CTCTTCCATCAACTGGGCACAGG + Intergenic
1036722062 8:11185204-11185226 CACTTATTCCACCTGGTCACAGG - Intronic
1037082979 8:14809027-14809049 CAATGAGATCAAATGGACACAGG + Intronic
1038269006 8:26060285-26060307 CTCTTGCATCAACTGGTCACAGG + Intergenic
1041739604 8:61144244-61144266 CAATTAGAACAAATGGACACAGG - Intronic
1042117523 8:65448387-65448409 CACTCATATAAACTTGAAACTGG + Intergenic
1045467555 8:102484395-102484417 ATCTTCTATCAACTGGCCACAGG - Intergenic
1045662200 8:104449651-104449673 CCCTTATATCAAGTGGAAACTGG + Intronic
1046160243 8:110353526-110353548 CAACTATAACAACTGGAAACAGG + Intergenic
1047506070 8:125481525-125481547 CACCTATATCAAGTGGAGCCTGG - Intergenic
1047810178 8:128400133-128400155 CAGTTATCTCAACTGTAAACAGG - Intergenic
1048714442 8:137252496-137252518 AACTCATATCAAAAGGACACAGG + Intergenic
1048830263 8:138469551-138469573 CACCTATTACAACTGGACAATGG + Intronic
1049914270 9:301459-301481 CACTTATATCAACATGGTACTGG + Intronic
1050725971 9:8649417-8649439 CTCATCTATCAACTGCACACTGG + Intronic
1052676126 9:31627274-31627296 CACTGAAATCAACTGGTCCCTGG + Intergenic
1053378105 9:37625605-37625627 CAATTATATCAACAGGACCCTGG - Intronic
1055074195 9:72196786-72196808 CAATAATAACAAATGGACACAGG - Intronic
1058797859 9:108515958-108515980 CACATATGTCAACCAGACACTGG - Intergenic
1061134632 9:128726477-128726499 CACTCATCTCAAATGGACAGAGG + Intergenic
1185987200 X:4848340-4848362 CAATTAGATCACTTGGACACAGG + Intergenic
1188555175 X:31403540-31403562 CATTTATATCCACTGAACAAAGG - Intronic
1191596636 X:62951509-62951531 CAATGATATCATTTGGACACAGG + Intergenic
1191928304 X:66340195-66340217 CAATTAGATCACATGGACACAGG + Intergenic
1192721851 X:73707331-73707353 CAATGAGATCACCTGGACACAGG + Intergenic
1193670218 X:84375691-84375713 CAATGATATCACATGGACACAGG + Intronic
1193688123 X:84604486-84604508 CAATGATATCACATGGACACAGG - Intergenic
1194021526 X:88697209-88697231 CAATGAGAACAACTGGACACAGG + Intergenic
1194990033 X:100537321-100537343 CAATGAGATCACCTGGACACAGG - Intergenic
1196504956 X:116430918-116430940 CACCTAAATCAACTGGGCAATGG - Intergenic
1196636665 X:118010537-118010559 CAATTAGATCACATGGACACAGG + Intronic
1198124299 X:133627111-133627133 CAATGAAAACAACTGGACACAGG + Intronic
1201406672 Y:13657076-13657098 CACTAAAATCAACAGGACATGGG - Intergenic
1201941514 Y:19465785-19465807 GACTTATGTCAACTGAGCACTGG - Intergenic
1202065338 Y:20933570-20933592 CAATTATATCATCTGCAAACAGG - Intergenic
1202242214 Y:22782705-22782727 CACAAAGATCAAGTGGACACAGG + Intergenic
1202395198 Y:24416449-24416471 CACAAAGATCAAGTGGACACAGG + Intergenic
1202475587 Y:25253643-25253665 CACAAAGATCAAGTGGACACAGG - Intergenic