ID: 1089042193

View in Genome Browser
Species Human (GRCh38)
Location 11:115462613-115462635
Sequence TTTGATGTGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1026
Summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 923}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089042185_1089042193 13 Left 1089042185 11:115462577-115462599 CCATGAACCTATTAAATATTCCA 0: 1
1: 0
2: 0
3: 26
4: 278
Right 1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG 0: 1
1: 0
2: 5
3: 97
4: 923
1089042183_1089042193 15 Left 1089042183 11:115462575-115462597 CCCCATGAACCTATTAAATATTC 0: 1
1: 0
2: 1
3: 19
4: 287
Right 1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG 0: 1
1: 0
2: 5
3: 97
4: 923
1089042186_1089042193 6 Left 1089042186 11:115462584-115462606 CCTATTAAATATTCCACAAATAA 0: 1
1: 0
2: 9
3: 61
4: 760
Right 1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG 0: 1
1: 0
2: 5
3: 97
4: 923
1089042187_1089042193 -7 Left 1089042187 11:115462597-115462619 CCACAAATAATTTATTTTTGATG 0: 1
1: 0
2: 7
3: 113
4: 882
Right 1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG 0: 1
1: 0
2: 5
3: 97
4: 923
1089042182_1089042193 26 Left 1089042182 11:115462564-115462586 CCAGAGCAGAGCCCCATGAACCT 0: 1
1: 0
2: 1
3: 17
4: 155
Right 1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG 0: 1
1: 0
2: 5
3: 97
4: 923
1089042184_1089042193 14 Left 1089042184 11:115462576-115462598 CCCATGAACCTATTAAATATTCC 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG 0: 1
1: 0
2: 5
3: 97
4: 923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089042193 Original CRISPR TTTGATGTGGAGGAGGAGGA GGG Intronic
900991238 1:6099344-6099366 ATTGGTGTGTAGGAGGAAGACGG - Exonic
901295155 1:8155763-8155785 TGTGGTTTGGAGGTGGAGGAAGG + Intergenic
901842621 1:11963706-11963728 GATGAGGAGGAGGAGGAGGAAGG - Intronic
901938492 1:12644446-12644468 AGTGAGGTGGAGGAGGCGGAGGG + Intergenic
902358724 1:15929085-15929107 GTTGAAGTGGTGGAGAAGGAAGG + Exonic
902980885 1:20122105-20122127 GATGATGAGGAGGAGGAGGACGG - Intergenic
903017691 1:20371932-20371954 TTTGATAATGAGGAAGAGGAGGG + Intergenic
903334187 1:22614017-22614039 TGTGAGGGGGAGGAGGAGGAGGG + Intergenic
903350651 1:22714488-22714510 TTTGATGTGTCTGAGGAGGGTGG + Intronic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904266304 1:29320234-29320256 TTTGATGAGGTGGTGGGGGAGGG + Intronic
904361109 1:29972392-29972414 TTTGATGTGGAGGAGAAGGCTGG - Intergenic
904829342 1:33296623-33296645 TTGGATGAGGAGGAGAAAGAGGG + Intronic
905052657 1:35065208-35065230 TAGGTTGTGGAGGAGGAGGAAGG - Intronic
905353058 1:37360693-37360715 CCAGGTGTGGAGGAGGAGGAGGG - Intergenic
905741493 1:40374642-40374664 AATGACGAGGAGGAGGAGGAGGG + Intronic
905770680 1:40636158-40636180 GTTGATGGGGAGGATGAGCAGGG + Intronic
906152041 1:43593030-43593052 TTTCATGGGGAGTATGAGGAAGG - Intronic
906559166 1:46742323-46742345 ATTGTTGTGGAGGATGAGGCTGG + Intergenic
906795099 1:48690314-48690336 TTTGATTTGGAGGATGGGGTGGG + Intronic
906837766 1:49102268-49102290 TTTAGAGTGGAGGAGGAGGCAGG + Intronic
907295516 1:53449889-53449911 GTTTATTTGGAAGAGGAGGAAGG - Intergenic
907473446 1:54689615-54689637 TTGGGTTTGAAGGAGGAGGAGGG + Intronic
907704993 1:56825296-56825318 TGGCATGTGGAAGAGGAGGAGGG + Intergenic
907744160 1:57196032-57196054 GGTGATGGGGAGTAGGAGGAAGG + Intronic
907811131 1:57871122-57871144 ATTGGTGATGAGGAGGAGGAGGG - Intronic
908293052 1:62687764-62687786 TTTGTTGGGGTGGAGGAGGGCGG + Intronic
908352940 1:63303904-63303926 TGTGTTGGGGAGGAGGAAGAAGG + Intergenic
908675212 1:66595911-66595933 TTTGAGGAGGGGGAGGAGGAAGG + Intronic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
909488993 1:76205632-76205654 TTTGATGTTGTAAAGGAGGAGGG + Intronic
909714327 1:78689742-78689764 TTTGTAGTGGAGGAGTAAGAAGG - Intergenic
909760457 1:79279766-79279788 TGTGATGGGGTGGAGGAGGAGGG + Intergenic
910000330 1:82333401-82333423 TGTGAGGAGGAGGAGGAGGCTGG + Intergenic
910770320 1:90824333-90824355 TTTGAGGTGGAGAAGAAGGAAGG - Intergenic
911201861 1:95052490-95052512 TTTGTTTTTCAGGAGGAGGATGG + Intronic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
912454297 1:109787499-109787521 TTTGTCTAGGAGGAGGAGGAGGG - Intergenic
912564387 1:110575868-110575890 TGTGTTGTGGAGGAGGAGAGGGG - Intergenic
912719982 1:112011957-112011979 TTTGATGGGATGGAGGTGGAGGG - Intergenic
912917940 1:113836255-113836277 TTTGATGTGGAAGATGATGAGGG - Intronic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913199338 1:116483533-116483555 TTTGATCTGGAGGATGTGAAGGG - Intergenic
913319303 1:117577288-117577310 TTTGCTGTTGGGAAGGAGGAAGG - Intergenic
913586625 1:120280797-120280819 TTTGGTGAGAAGGAAGAGGAGGG - Intergenic
913621561 1:120617573-120617595 TTTGGTGAGAAGGAAGAGGAGGG + Intergenic
913672585 1:121111548-121111570 TTTTCTGTTGAGGAGGAGTATGG + Intergenic
914024354 1:143898913-143898935 TTTTCTGTTGAGGAGGAGTATGG + Intergenic
914385201 1:147162469-147162491 CTTGAAGTAGATGAGGAGGAAGG + Exonic
914568640 1:148892660-148892682 TTTGATGAGAAGGAAGAGGAGGG - Intronic
914604187 1:149237592-149237614 TTTGGTGAGAAGGAAGAGGAGGG + Intergenic
914662836 1:149806934-149806956 TTTTCTGTTGAGGAGGAGTATGG + Intronic
914802448 1:150971521-150971543 TGTGATTTGGGGGAGGAGGAGGG - Intronic
915072426 1:153281617-153281639 TTGGATGTGGATGAAGAGGAAGG + Intergenic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915862401 1:159458806-159458828 CTTGTTGTGGGGGAGGGGGAGGG + Intergenic
916055447 1:161066209-161066231 TGTGGTGTGCAGGAGGATGAAGG - Intronic
916187195 1:162145010-162145032 CTTAATGTTGAGGAGCAGGAAGG + Intronic
916332076 1:163628341-163628363 ATGGAGGGGGAGGAGGAGGAGGG - Intergenic
916450721 1:164917897-164917919 TTGGAAGTGGAGGAGTGGGAGGG - Intergenic
917175021 1:172224494-172224516 TTTGATGAAGATGAGGTGGATGG + Intronic
918126030 1:181584773-181584795 TATAATGTGGAGGAGGTGGTAGG - Intronic
918553480 1:185771375-185771397 TTTGGTGTGAAGTATGAGGAGGG + Intronic
918626622 1:186663092-186663114 TGTGTTGGGGGGGAGGAGGAAGG - Intergenic
918910308 1:190559310-190559332 TTGGTTTTGGAGAAGGAGGATGG - Intergenic
919085780 1:192918757-192918779 GATGTTGGGGAGGAGGAGGAAGG + Intergenic
919811032 1:201408965-201408987 TAACAAGTGGAGGAGGAGGAGGG - Exonic
920011528 1:202871464-202871486 TGCTATGTGGTGGAGGAGGATGG - Intergenic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920097624 1:203496852-203496874 GTCACTGTGGAGGAGGAGGAGGG - Intronic
920199760 1:204252338-204252360 TGGGATGAGGAGGAAGAGGAAGG + Intronic
920437216 1:205955122-205955144 TTTGTTAGGGAGGGGGAGGAGGG - Intergenic
920491610 1:206419971-206419993 TTGGCTGGGGTGGAGGAGGAAGG - Intronic
920518554 1:206604939-206604961 TTTCATGAGGAGGAGGAGTCTGG + Intronic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
921928425 1:220732786-220732808 TTTTTAGGGGAGGAGGAGGAGGG - Intergenic
922082161 1:222308040-222308062 GATGGTGAGGAGGAGGAGGAAGG - Intergenic
922209789 1:223478543-223478565 TTTGATTGATAGGAGGAGGAAGG + Intergenic
922247727 1:223817193-223817215 CTGCATGTGGAGGAGGGGGAGGG + Intronic
922936285 1:229425684-229425706 GTTGAAGAAGAGGAGGAGGAGGG + Intergenic
922960660 1:229643128-229643150 GTTGAGGAGGAGGAAGAGGAGGG + Intronic
922980057 1:229818157-229818179 TTTCATAGGGAGGAGGAGGTAGG - Intergenic
923207830 1:231775913-231775935 TGTGATGTGGGGGTGGGGGAGGG + Intronic
923321170 1:232834993-232835015 TGGGATGAGGAGGAGGATGATGG - Intergenic
923871448 1:237998557-237998579 TTAGATATGGAGGAGGAAGATGG - Intergenic
923920670 1:238561080-238561102 GAAGAAGTGGAGGAGGAGGAGGG - Intergenic
924464933 1:244291218-244291240 TCTCAAGTGGAGGAGAAGGAGGG + Intergenic
924624907 1:245689427-245689449 TTTGGGGTGGAGGTGGAGGAAGG - Intronic
924816151 1:247443692-247443714 TGTGAGGAGGAGGAGGAGTATGG + Intronic
924907630 1:248473493-248473515 GTGGATGAGGAGGATGAGGAGGG - Exonic
924916479 1:248574593-248574615 GTGGATGAGGAGGATGAGGAGGG + Exonic
1062961602 10:1576798-1576820 TTGAAGGTGGAGGATGAGGAGGG + Intronic
1063097084 10:2917785-2917807 TCTGATATGGAGGAGGGAGAGGG - Intergenic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063287350 10:4705010-4705032 TTAGATGGAGAAGAGGAGGAGGG + Intergenic
1063443164 10:6089446-6089468 CATGAGGAGGAGGAGGAGGAAGG - Exonic
1063618283 10:7621387-7621409 TTTGATATGGACCATGAGGAAGG + Intronic
1064002297 10:11673741-11673763 TAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1064193966 10:13230627-13230649 TCTGATGTGCAAGAGGAGGCTGG + Intronic
1064731516 10:18335908-18335930 TTTGAAGAGAAGGATGAGGATGG - Intronic
1065139171 10:22703841-22703863 TTGGATGTGGAGAAGGAGTGGGG + Intronic
1067031661 10:42882192-42882214 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1067419510 10:46134052-46134074 ACTGATGTGGAGGGGCAGGAAGG + Intergenic
1067426507 10:46215359-46215381 ACTGATGTGGAGTGGGAGGAAGG - Intergenic
1067504862 10:46840649-46840671 ACTGATGTGGAGGGGCAGGAAGG + Intergenic
1067511069 10:46895517-46895539 TTGGATGGGGAGGATGGGGAAGG + Intergenic
1067651184 10:48156345-48156367 TTGGATGGGGAGGATGGGGAAGG - Intergenic
1068361236 10:55976807-55976829 TTTGATGTGTAGGGAAAGGAGGG - Intergenic
1069448491 10:68496134-68496156 TTTGATGTGCAGGAGACAGATGG - Intronic
1069458619 10:68573634-68573656 TTGGATTTGGAGGAACAGGAAGG - Exonic
1069555408 10:69394575-69394597 TGTGTTGTGAAGGAGGAGAATGG + Intronic
1069930429 10:71877994-71878016 ATTGATGTGGTGAGGGAGGAGGG + Intergenic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1070896400 10:79986192-79986214 TTGGAAGTGGAGGAGAATGATGG + Intergenic
1071373528 10:84978241-84978263 TATGATGATGAGGAGGAGAATGG - Intergenic
1071390555 10:85171142-85171164 TATGGTGTGGATGAGGAGAAAGG + Intergenic
1071718617 10:88120859-88120881 CTTCAGGTGAAGGAGGAGGAAGG - Intergenic
1072506806 10:96076058-96076080 GTTGATGTGGGGGTGGGGGAAGG - Intergenic
1072687070 10:97543864-97543886 TTTGCTGTGGAGCAGGGGGCTGG + Intronic
1072778648 10:98227339-98227361 TTTTATTGGGAGAAGGAGGAAGG - Intronic
1072895720 10:99365021-99365043 TACGATGGGGAGGACGAGGAAGG - Intronic
1073037856 10:100576614-100576636 GTTGAGGAGGAGGAGGATGAAGG - Intergenic
1073426765 10:103459731-103459753 TTTGATGTGTCTGTGGAGGAGGG - Intergenic
1073886222 10:108042965-108042987 ATTGATGGTGAGGGGGAGGAAGG - Intergenic
1074301121 10:112234215-112234237 GCAGATGTGGGGGAGGAGGAGGG - Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074412714 10:113242245-113242267 TGGCATGTGGAGGAGCAGGATGG + Intergenic
1075465520 10:122647721-122647743 TGTGGTGTGGATGGGGAGGATGG - Intergenic
1075599990 10:123760784-123760806 GATGAAGAGGAGGAGGAGGATGG - Intronic
1075785998 10:125050537-125050559 TCTGATGGGGAGGAGGAGGGTGG + Intronic
1076142717 10:128092690-128092712 TTTGATGTTGGGAGGGAGGAGGG - Intergenic
1076462287 10:130655572-130655594 TCTCATGTGGGGGCGGAGGAGGG - Intergenic
1077782493 11:5346839-5346861 TTTGATGGTGAGGAAGAGCAGGG + Intronic
1078105220 11:8354173-8354195 TTTCATGTGGAGAAAGAGCAAGG - Intergenic
1078142997 11:8705141-8705163 TTTGAGCTGCAGGAGCAGGAGGG - Intronic
1078258198 11:9679232-9679254 TTTGATTTGAAGGAGGAGAATGG + Intronic
1078451360 11:11443241-11443263 TGAGTTGTGGAGAAGGAGGATGG - Intronic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079238157 11:18704143-18704165 GTAGATGTGGAGGAGGGGAAGGG + Exonic
1079396636 11:20069305-20069327 TTGGATGTGGAGGAGAGGTAAGG + Intronic
1079691156 11:23418975-23418997 GATGATGAGGAGGAGGAGGATGG + Intergenic
1079810956 11:24999387-24999409 GAAGATGGGGAGGAGGAGGAAGG + Intronic
1080299148 11:30764979-30765001 TTTGTTGTGGGGGAGGAGACAGG + Intergenic
1080396226 11:31892769-31892791 TTTGATGGGGAGAAGGAAGCAGG - Intronic
1081203428 11:40246337-40246359 TTTGATGTCTAGAAGGAGTATGG - Intronic
1081499639 11:43653543-43653565 TGTGAGGTGGGGGAGGGGGAAGG - Intronic
1082784108 11:57307449-57307471 TTTGGGATGGAGGAGGAGAAGGG - Intronic
1083291381 11:61692251-61692273 TCTGATGTGGAGGAGGGTGGTGG - Intronic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1083922442 11:65787956-65787978 AGTGTTGTGGGGGAGGAGGAAGG - Intronic
1084156040 11:67313039-67313061 TTTGCTTTGTAGCAGGAGGAAGG - Intergenic
1084177082 11:67428564-67428586 TTGGATTTGGAGACGGAGGAAGG + Exonic
1084493845 11:69492455-69492477 TTATAAGTGGAGGAGGAGGCAGG + Intergenic
1084569502 11:69950910-69950932 TTGGAGGTGGAGGAGGAGTAGGG + Intergenic
1084583525 11:70039663-70039685 CTTGAGGTGGAGGGGGAGGTGGG - Intergenic
1084949674 11:72657727-72657749 TTGGATCTGGGGGAGGAGCAGGG + Intronic
1085009036 11:73123687-73123709 TTTGAAGTGGTGGAGGGGGATGG - Intronic
1085871887 11:80359822-80359844 TAGGAGGTGGAGGAGGTGGAAGG + Intergenic
1085967959 11:81551952-81551974 TTTTATGAGGAAGAGGAGGAGGG - Intergenic
1086499127 11:87434220-87434242 GTTGATGCTTAGGAGGAGGAGGG + Intergenic
1086898867 11:92343798-92343820 TATGATATGGTGTAGGAGGAAGG + Intergenic
1086953298 11:92912301-92912323 TTGGATGTGGGGTATGAGGAAGG - Intergenic
1087225155 11:95591060-95591082 GAGGATGTGGAGGAGGATGAGGG + Intergenic
1087260204 11:96002598-96002620 GATGATGGGGATGAGGAGGATGG + Intronic
1087594757 11:100238529-100238551 GTAGAAGAGGAGGAGGAGGAGGG + Intronic
1087672966 11:101128394-101128416 GTGGAGGTTGAGGAGGAGGATGG - Exonic
1088280354 11:108128702-108128724 AATGATGTAGAGGAGAAGGAAGG + Intronic
1088519094 11:110675490-110675512 GGAGTTGTGGAGGAGGAGGAAGG + Intronic
1088751427 11:112845260-112845282 TTTGATTTGGAGGCCAAGGAAGG - Intergenic
1088857896 11:113773035-113773057 TTTAATGTCGGGGAGGAGAAAGG + Intronic
1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG + Intronic
1089209063 11:116788556-116788578 TATGATGGGGATGAGGAGGTAGG - Intergenic
1089767016 11:120775320-120775342 GATGACGGGGAGGAGGAGGAAGG + Intronic
1090003424 11:122980808-122980830 TTAGATGTTGAGGATGCGGAGGG + Intronic
1090026696 11:123173760-123173782 TTTGATGTGGTGAAGGAGTGCGG - Intronic
1090147273 11:124339004-124339026 GTTGATGTGGAGGATGATGTAGG + Intergenic
1090213932 11:124943574-124943596 TGGGATGTGGAAGAGGAGGAAGG + Intergenic
1090537461 11:127659418-127659440 ATTGATGTGAATGAGGAGCATGG + Intergenic
1090620185 11:128553695-128553717 GCTGAGGAGGAGGAGGAGGAGGG - Intronic
1091100616 11:132869330-132869352 TTTGGTGGGAAGGAGGAGGCGGG - Intronic
1091349420 11:134881140-134881162 TTGGATGCTGAGGATGAGGATGG + Intergenic
1091603184 12:1930082-1930104 GAGGAGGTGGAGGAGGAGGAAGG + Intergenic
1091632810 12:2174956-2174978 TAGGAAGAGGAGGAGGAGGAGGG + Intronic
1091644946 12:2266203-2266225 ATTGTTCTGGAGGTGGAGGAAGG - Intronic
1092125783 12:6074137-6074159 TTTCATGGGGAAAAGGAGGAGGG - Intronic
1092139259 12:6171613-6171635 GTTGAGGAGGAGGAGGAGGAAGG + Intergenic
1092216628 12:6688534-6688556 TTAGAGATGGAGGAGGAGGAGGG + Intronic
1092533332 12:9363425-9363447 CCTGCTGTGGAGGAGGAGGGTGG - Intergenic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1093450333 12:19306502-19306524 TTTGATGTGTTGAAGCAGGAGGG + Intronic
1093590181 12:20893546-20893568 ATTGATGTGGAGGTTGTGGAAGG + Intronic
1093760367 12:22903121-22903143 CTTGTTGTGGAGTAGGGGGAGGG + Intergenic
1095823701 12:46509054-46509076 TTTGGGTTGGAAGAGGAGGAAGG - Intergenic
1095854170 12:46842380-46842402 CATAGTGTGGAGGAGGAGGAGGG + Intergenic
1096200324 12:49677098-49677120 TGTGAATTGGAGGAGGAGCATGG - Intronic
1096266929 12:50131004-50131026 TTTGAAGTGGAAGAAGAGAAAGG - Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096976891 12:55704285-55704307 TCTGATGGGGTGGAGGGGGAGGG + Intronic
1097258094 12:57695904-57695926 TAAGAGGAGGAGGAGGAGGAGGG - Intronic
1097740598 12:63237746-63237768 GATGATGATGAGGAGGAGGAAGG + Intergenic
1097848455 12:64389488-64389510 TTTGCTGGGGAGGGGGTGGAGGG + Intronic
1097970509 12:65628228-65628250 TGGGATGTGGAGGTGGAGAAAGG - Intergenic
1098353005 12:69583398-69583420 TTGGATGGGGAGAAGGAGGCAGG - Intergenic
1098566216 12:71939444-71939466 TATTATGAGGAGGAGGAGTAGGG + Intronic
1098905690 12:76159917-76159939 TGTGAAGTGTAGTAGGAGGAGGG - Intergenic
1099068341 12:78012559-78012581 TTTGTTGAGAAGGAGGATGAAGG - Intronic
1099087087 12:78258646-78258668 TTTGTTGGGGAGGTGGAGCAGGG - Intergenic
1099941606 12:89195634-89195656 TGTGTTGTGGGGGAGGAGGAAGG - Intergenic
1100687799 12:97005547-97005569 TTTTATTTGGAGGAGGATGCAGG - Intergenic
1100837262 12:98578151-98578173 TTTTTTGTGGGGGAGGGGGATGG - Intergenic
1100912433 12:99380800-99380822 TTTGTTGTGGAGCATGAGAAAGG - Intronic
1101081478 12:101189802-101189824 TGTGATGTGAAGGTGGAGGATGG - Intronic
1101147391 12:101854046-101854068 TTTGGTTTGAGGGAGGAGGAAGG + Intergenic
1101195781 12:102380702-102380724 GTGGATGTGGAGAAAGAGGATGG + Intergenic
1101346157 12:103888214-103888236 TGTGATGTGGAGGAGAGAGAAGG - Intergenic
1101397768 12:104363495-104363517 ATTCATGATGAGGAGGAGGATGG + Intergenic
1101495926 12:105254095-105254117 TGAGATGTGGAGTAGGAGAAAGG - Intronic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1102008795 12:109605732-109605754 TTTGATGAGGAGTAGGGTGAAGG + Intergenic
1102264331 12:111469814-111469836 ATTGATGAGGAAGAGGAGAAAGG + Intronic
1102285573 12:111653638-111653660 GTTGATGTGGAGGAGGGGTGTGG - Intronic
1102436926 12:112931279-112931301 TGTGAGGTGGAGGAGCATGATGG + Intronic
1102589240 12:113945234-113945256 TGTGATATGGAGGAGCTGGATGG + Intronic
1102655628 12:114480350-114480372 GGTGAGGAGGAGGAGGAGGAAGG + Intergenic
1102807622 12:115795686-115795708 TTTGTGGAGGAGGTGGAGGAGGG - Intergenic
1102988584 12:117298487-117298509 TTTGATGGGGATGGGGAGGGAGG - Intronic
1103073480 12:117963890-117963912 TTTGGAGTGAAGGATGAGGAGGG - Intronic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103441654 12:120967493-120967515 TTTGTTGTTGAAGAAGAGGATGG + Intergenic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103765018 12:123273602-123273624 TTTGAGATGGAGGTGGAGGCGGG - Intergenic
1104042163 12:125137639-125137661 TTCTAAGTGGGGGAGGAGGAGGG + Intronic
1104088275 12:125494441-125494463 TTTGGGGAGGAGGGGGAGGAGGG - Intronic
1104164444 12:126214449-126214471 TCTGATGAGGAGGAGGTGAAAGG - Intergenic
1104402275 12:128485867-128485889 TTAGAGGAGGAGGAGGAAGAAGG - Intronic
1104788233 12:131465305-131465327 TGAGAGGTGGAGGAGGTGGAAGG - Intergenic
1104841342 12:131827505-131827527 TTTGGGGTGGTGGAGCAGGAGGG + Intergenic
1104901684 12:132192784-132192806 TTAGAGGAGGAGGAGGAGGGAGG - Intergenic
1105775918 13:23659964-23659986 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
1105935919 13:25099034-25099056 TTATATTGGGAGGAGGAGGAGGG - Exonic
1106068987 13:26388848-26388870 GTTGGTGAGGAGGAGGAGGGAGG - Intronic
1106068988 13:26388851-26388873 TATGTTGGTGAGGAGGAGGAGGG - Intronic
1106286525 13:28322789-28322811 AGTGATGTTGAGGAAGAGGAGGG - Exonic
1106703407 13:32254368-32254390 CTAGATGTGGAGCTGGAGGATGG + Exonic
1106805586 13:33303159-33303181 TTTCATGGGAATGAGGAGGAAGG - Intronic
1107368339 13:39711589-39711611 ACTGATGAGAAGGAGGAGGAAGG - Intronic
1108095689 13:46898179-46898201 TTTAACGTGGAGGGGTAGGAGGG - Intergenic
1108313624 13:49218476-49218498 ACTGAAGTGGAGGTGGAGGAAGG + Intergenic
1108596193 13:51951692-51951714 GGGGATGAGGAGGAGGAGGAGGG + Intronic
1108687717 13:52835267-52835289 TGTGATGGGGAGGGGGAGGGGGG + Intergenic
1109771328 13:66977452-66977474 TTTGTTGTTGATGAGAAGGAGGG - Intronic
1111412446 13:87894621-87894643 TTAGATTTGGAGGAACAGGAAGG + Intergenic
1112219454 13:97473344-97473366 TTTGATGTGGAGGATTGGAAGGG - Intergenic
1112406965 13:99129818-99129840 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1112454463 13:99546045-99546067 TTTCAGGTCGAGGAGGAGAAAGG + Intronic
1112776166 13:102846151-102846173 TTTGTTGTGTAGGAGCAGGGAGG + Exonic
1112877016 13:104054844-104054866 TTACGTGTGGATGAGGAGGAGGG - Intergenic
1114454406 14:22845869-22845891 ATTGAGGTGGACGAGGAGGGCGG + Exonic
1114831897 14:26153812-26153834 TCTTATGTGGAGGAAGAGAAGGG - Intergenic
1115027699 14:28763213-28763235 TTTGAAATGGAGGGGGAGGGGGG - Intergenic
1115283647 14:31693427-31693449 TTGGATGAGGTGGATGAGGATGG - Intronic
1115343499 14:32317743-32317765 TTTGATGTGTAGGGGAAGAAAGG - Intergenic
1116055220 14:39855453-39855475 AGTGATGAGGAGGAGGAGGAAGG - Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1116520124 14:45836196-45836218 GAAGATGTGGAGGAGGTGGAAGG + Intergenic
1116665124 14:47764850-47764872 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1116864208 14:50018154-50018176 TTTGATGTGGGAGTGGAGCAGGG + Intergenic
1117203002 14:53411624-53411646 TTTGATGTTGTGGGGGAGGGTGG - Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117957062 14:61130973-61130995 TTTGTCCTGGAGGAGGAGGGAGG - Intergenic
1118045827 14:61970189-61970211 GTTGATGAAGAGGAAGAGGACGG - Intergenic
1118285977 14:64473259-64473281 TTTGAGGTGGAGGAGGTGGCAGG - Exonic
1118701229 14:68435175-68435197 CTAGATGGGGAAGAGGAGGATGG - Intronic
1118773734 14:68960175-68960197 GAAGAGGTGGAGGAGGAGGAAGG + Intronic
1118778093 14:68986459-68986481 TGTGTTGTGGGGGAGGTGGAGGG - Intergenic
1118948147 14:70408109-70408131 TTTTTTTTGGAGGAGGGGGAAGG + Intronic
1119019302 14:71093720-71093742 TCAGAGGTGGAGGAGGTGGAAGG - Intronic
1119055710 14:71417643-71417665 GCAGAGGTGGAGGAGGAGGAAGG + Intronic
1119317831 14:73710162-73710184 GTACATGTGGAGCAGGAGGAGGG + Intergenic
1119382551 14:74238551-74238573 GTTGATGTGGAGGGAGAGGAAGG - Intergenic
1119425338 14:74531398-74531420 AGTGATGTGGAGTAGAAGGAAGG + Intronic
1119769594 14:77212108-77212130 TAAGCTGAGGAGGAGGAGGATGG + Intronic
1119849757 14:77858816-77858838 TTTGATGAAGAGGAGGAGATAGG + Intronic
1120059337 14:79963773-79963795 TTGGATTTGGAGGAGGAGGAGGG - Intergenic
1120097831 14:80408931-80408953 TTTGGTGTGGAGAGGAAGGAGGG + Intergenic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1121085860 14:91145626-91145648 TGTGAGGAGGAGGAGGGGGATGG - Intronic
1121173490 14:91873254-91873276 AAAGATGAGGAGGAGGAGGATGG + Intronic
1121433413 14:93903204-93903226 TTTGCTGTGGAGCAGGTGGAGGG + Intergenic
1121692725 14:95889468-95889490 GTGGAGGCGGAGGAGGAGGAGGG - Intergenic
1122185938 14:99996072-99996094 TTTGATGGGGTGGTGGGGGAGGG - Intronic
1122198976 14:100110547-100110569 TCTGATGAGGAGGAGGACGGCGG + Intronic
1122780805 14:104142659-104142681 TTAGATGTGGAGAAAGAGGGAGG - Intronic
1123424043 15:20154593-20154615 TTTGATGTGGAATATGATGAAGG + Intergenic
1123533263 15:21161122-21161144 TTTGATGTGGAATATGATGAAGG + Intergenic
1123820913 15:24029442-24029464 TAAGATGTGGAGGTGGACGATGG + Intergenic
1124231981 15:27953617-27953639 TTGGAGGTGGAGGAGTAGGCAGG + Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124868812 15:33520446-33520468 CCTGATGAGGAGGAGGAGTATGG + Intronic
1125447632 15:39775011-39775033 TTTGCAGTGGGGGAGGTGGAGGG + Intronic
1125463160 15:39925278-39925300 TGTGATGGGGAGCAGGAGGGAGG - Intergenic
1125500693 15:40238909-40238931 GCTGAAGGGGAGGAGGAGGAAGG - Intronic
1125511222 15:40293449-40293471 TGGGAAGAGGAGGAGGAGGAAGG + Intronic
1125871413 15:43105642-43105664 TTTGATGTGGGGGCCGAGGCGGG - Intronic
1125935515 15:43632125-43632147 ATAGCTGTGGAGAAGGAGGAGGG - Intronic
1125948289 15:43728592-43728614 ATAGCTGTGGAGAAGGAGGAGGG - Intergenic
1127182314 15:56434799-56434821 TTTGATTTTGAGGAGGAGGTTGG - Intronic
1127331276 15:57942582-57942604 TTTGATGGGGAGAAGGAGCTAGG - Intergenic
1127630895 15:60826661-60826683 TTTCCCATGGAGGAGGAGGAGGG + Intronic
1128106396 15:65048657-65048679 TGTCTTGGGGAGGAGGAGGAAGG - Intronic
1128185062 15:65637842-65637864 TTTGAGGTGGGTGAAGAGGATGG + Intronic
1128645692 15:69377304-69377326 TTTGATCCTGTGGAGGAGGACGG - Intronic
1129361278 15:75026129-75026151 CTTGATGTGGAGGAGGTTCAGGG + Intronic
1130071939 15:80654842-80654864 TTTAATGTGGAAAAGAAGGAGGG - Intergenic
1130260988 15:82354210-82354232 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1130280247 15:82514808-82514830 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130471622 15:84230994-84231016 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130479116 15:84345565-84345587 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130492655 15:84442566-84442588 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1130593918 15:85235622-85235644 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130613135 15:85379605-85379627 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1131018244 15:89075512-89075534 TGTGAAGGGGAGGAGAAGGAGGG + Intergenic
1131169942 15:90170736-90170758 TGTGATGTGGGGTAGGAGAAAGG + Intronic
1131668659 15:94596636-94596658 GTTGAACTGGAGGAGGTGGAGGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1133110110 16:3542999-3543021 TTTGAAATGGAAGAGGAGGAAGG - Intronic
1133442098 16:5829473-5829495 TGTCATTTGGGGGAGGAGGAGGG + Intergenic
1133580485 16:7139899-7139921 TTGGCTGTGGAGGAGGAAGAAGG + Intronic
1133710118 16:8393259-8393281 TTTGCTATGGAGGAAGGGGAAGG - Intergenic
1133838995 16:9391925-9391947 TTTGATGTGGAGCTGGAGAACGG + Intergenic
1133897621 16:9944465-9944487 GATGGTGAGGAGGAGGAGGATGG - Intronic
1134000519 16:10779425-10779447 GTTGCTGGGGAGCAGGAGGATGG - Intronic
1134615662 16:15649795-15649817 TTTGGTGTAAAGGAGTAGGAAGG + Intronic
1135066575 16:19315004-19315026 GTGGAGGGGGAGGAGGAGGAGGG + Intronic
1135114519 16:19713563-19713585 ATGGAGGTGGAGGAGGAGGATGG + Intronic
1135308607 16:21388150-21388172 TTTGATTTGGAGGCGAAGAAAGG + Intergenic
1135542521 16:23342837-23342859 TCTGATGGGGAGGAGGAGGGTGG + Intronic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135795382 16:25436408-25436430 AGTGATGAGGAGGAAGAGGATGG - Intergenic
1135967069 16:27044645-27044667 CTTGAGGAAGAGGAGGAGGAAGG - Intergenic
1136148187 16:28328459-28328481 TTTGATTTGGAGGCGAAGAAAGG + Intergenic
1136271050 16:29148503-29148525 GTGGGTGTGGAGGAGCAGGAGGG - Intergenic
1136305349 16:29367281-29367303 TTTGATTTGGAGGCGAAGAAAGG + Intergenic
1136409473 16:30067689-30067711 TTTGAGATGGAAGTGGAGGAAGG + Intronic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137389700 16:48071051-48071073 TTTGAAGTGGGGGTTGAGGAGGG + Intergenic
1137585184 16:49660003-49660025 TTGCGGGTGGAGGAGGAGGAAGG - Intronic
1137826044 16:51496191-51496213 TTTGGTGTGGGGAGGGAGGACGG + Intergenic
1138157937 16:54722991-54723013 CTGGAGGTGGAGGATGAGGATGG + Intergenic
1138437967 16:57016804-57016826 TCTGAATTGGAGGAGGAAGAGGG + Intronic
1138664737 16:58555947-58555969 TTTTATGGGGAAGTGGAGGAAGG - Intronic
1138981973 16:62280743-62280765 TTAGGTGAGGAGGTGGAGGAGGG - Intergenic
1139010795 16:62631459-62631481 TGTGAGGTGGAGGAGGGGGAAGG - Intergenic
1139182162 16:64761357-64761379 GATGAAGTGGAAGAGGAGGAGGG + Intergenic
1139886464 16:70211557-70211579 TTTGTGGTGGGGGAGGGGGAAGG + Intergenic
1140453727 16:75092257-75092279 GCTGAAGAGGAGGAGGAGGAGGG + Intronic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141138993 16:81484926-81484948 TTTCAGGGGTAGGAGGAGGAAGG - Intronic
1141184098 16:81774684-81774706 TTGGAGGTGGTGGTGGAGGAGGG + Intronic
1141490194 16:84367688-84367710 GATGATGAAGAGGAGGAGGATGG + Intergenic
1141530509 16:84643395-84643417 TGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1141885698 16:86890753-86890775 GATGATGGGGAGGAGGAGAATGG - Intergenic
1142044010 16:87913696-87913718 TGTGGGGTGGAGGAGGAGGGAGG - Intronic
1142074664 16:88110508-88110530 GTGGGTGTGGAGGAGCAGGAGGG - Intronic
1142766108 17:2065199-2065221 CGCCATGTGGAGGAGGAGGAGGG + Intronic
1143015767 17:3890416-3890438 CCTGGTGTGGAGGATGAGGAGGG - Intronic
1143139776 17:4735116-4735138 TGTGCTGTGCAAGAGGAGGAGGG - Exonic
1143818630 17:9541289-9541311 TGAGATGTGGAAGAGGAGAATGG + Intronic
1143980488 17:10865258-10865280 TTGAATGTGAAGGAAGAGGATGG - Intergenic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144535574 17:16086419-16086441 CTTGATGTGGAGCAGGCTGAAGG + Exonic
1144814990 17:18027683-18027705 TTTGGTGTGGACGAGGGGGCTGG + Intronic
1144952564 17:19002118-19002140 TTAGAGGAAGAGGAGGAGGAGGG - Intronic
1144965098 17:19072187-19072209 TTGGATGTGGGGGTGGCGGAGGG - Intergenic
1144982869 17:19179993-19180015 TTGGATGTGGGGGTGGCGGAGGG + Intergenic
1144985354 17:19198246-19198268 TTGGATGTGGGGGTGGCGGAGGG - Intergenic
1145030703 17:19502739-19502761 ACTGTTGTGGAGGAGGCGGAAGG - Intronic
1145302471 17:21650332-21650354 TATGCTGAGGAGGAGGATGATGG + Intergenic
1145792136 17:27633980-27634002 TTCCATGTGGTGCAGGAGGATGG - Intronic
1145922558 17:28621371-28621393 TTTGATGCAGAGGAGGGGGAGGG + Intronic
1145994086 17:29095769-29095791 TTTGATGTGGAGTTGGGGTAAGG - Intronic
1146513089 17:33467474-33467496 TATGATGGGAAGGAGGAGGTAGG + Intronic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1146656432 17:34637709-34637731 GTTGATGAGGAAGACGAGGATGG - Exonic
1146657617 17:34644254-34644276 TTTGCTGTGTCGGAGGAGGCTGG + Intergenic
1146773950 17:35595640-35595662 TTTGATTGGGGGGAGGAGGAGGG + Intronic
1146789808 17:35744972-35744994 GTAGGTGAGGAGGAGGAGGAAGG - Exonic
1146915607 17:36676444-36676466 GTAGAGGAGGAGGAGGAGGAGGG + Intergenic
1147322042 17:39652501-39652523 TGTGATTTGGAGCAGGAGGGTGG + Intronic
1147387138 17:40089368-40089390 TTTCATGTGGAGGAAGCGGCTGG - Intronic
1147770644 17:42865840-42865862 TTTTATTTGGAACAGGAGGACGG - Intergenic
1147865661 17:43550398-43550420 TTTTTTGTGGAGGAGGTGCAGGG + Intronic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148271460 17:46265401-46265423 TAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148689446 17:49518609-49518631 GGTGAGGAGGAGGAGGAGGATGG - Intergenic
1148808207 17:50274709-50274731 TTTGCTGTGGAGGTGGAGGTGGG + Intronic
1148861649 17:50607669-50607691 TTTGATGTGAAGCAGTAGGGAGG - Intronic
1149417852 17:56478947-56478969 AATGATGATGAGGAGGAGGAGGG + Intronic
1149613696 17:57978360-57978382 GTAGAGGTGGAGGAGGAAGAAGG + Intronic
1149634623 17:58156929-58156951 TTTTTTGTGGGGGAGGAGGGAGG - Intergenic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1149866933 17:60156360-60156382 TCTGTGGAGGAGGAGGAGGAGGG + Intronic
1150131636 17:62672334-62672356 TTGGAGGTGGAGGTGGAGGTAGG - Intronic
1151325399 17:73376867-73376889 TCTGGGGTGAAGGAGGAGGAAGG - Intronic
1151361709 17:73593100-73593122 TGGGGTGGGGAGGAGGAGGAGGG - Intronic
1151444494 17:74154292-74154314 TTGGAGGTGGAGGAGTAGAAAGG - Intergenic
1151544482 17:74784402-74784424 TGTGATCTGGAGGGGAAGGAAGG + Intronic
1152356848 17:79811658-79811680 TTTGAAGAGAAGGAGGACGAGGG - Intergenic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1152594304 17:81230757-81230779 ATTGATGAGGAGGAAGAAGAGGG - Intronic
1153141522 18:1977914-1977936 GAAGAGGTGGAGGAGGAGGAAGG - Intergenic
1153344858 18:4014369-4014391 TTTGCTGTGAAGGATAAGGATGG - Intronic
1153514534 18:5891618-5891640 ACGGACGTGGAGGAGGAGGACGG + Exonic
1154095956 18:11414808-11414830 TCTGGTGTGGAGGAGGAAGTGGG + Intergenic
1154338078 18:13481890-13481912 TTTGCTGGGCAGGAGGGGGAAGG + Intronic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155220880 18:23684575-23684597 TTTGGTGGGTGGGAGGAGGAAGG - Intergenic
1155374600 18:25142075-25142097 TTTGGTGTGATGGGGGAGGAGGG - Intronic
1155468970 18:26170763-26170785 TCTGATGTCCAGGAGGAGAAAGG - Intronic
1155734186 18:29200847-29200869 TTTGGTGGGGAGAAGCAGGAGGG + Intergenic
1156407505 18:36796842-36796864 TTAGAAGTGGAGGAAGTGGAGGG + Intronic
1156482660 18:37445881-37445903 GATGATAAGGAGGAGGAGGATGG - Intronic
1156620939 18:38850834-38850856 AGTGATGTGGAGAAGGAGGGTGG - Intergenic
1156683950 18:39621833-39621855 TTTAATGTGCAGGAGTACGAGGG - Intergenic
1157130353 18:45001591-45001613 TTTGAGGAGGAGCAGCAGGAAGG + Intronic
1157181990 18:45506260-45506282 TTTGATGGGGAGAAGAAGGTTGG - Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157498685 18:48173960-48173982 GTTGATGGGGTGGAGGATGAAGG - Intronic
1157539262 18:48488072-48488094 ATTGTTGTGGAGGAGGTGGTGGG - Intergenic
1158418999 18:57275988-57276010 TGTGATGTGAAGGAGGTAGAAGG - Intergenic
1159016157 18:63103047-63103069 TGGGATGTGGAGGTGGAGGCAGG + Intergenic
1159339149 18:67112278-67112300 AGTGATGTGGAGGGGGAGGGCGG - Intergenic
1160031818 18:75268657-75268679 TTTTTTGGGGAGGGGGAGGAGGG - Intronic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160582871 18:79897628-79897650 GGGTATGTGGAGGAGGAGGAGGG - Intronic
1160705187 19:526252-526274 TTGGAGGTGAAGGGGGAGGAAGG - Intergenic
1160819711 19:1052344-1052366 CTTGAGGAGGAGGAGGGGGAGGG + Intronic
1160946575 19:1646561-1646583 TGTGATGGGGCGGAGCAGGACGG - Intronic
1160958831 19:1708187-1708209 CTGGCTGTGGAGGTGGAGGAAGG - Intergenic
1161352775 19:3803229-3803251 TGTGAGGTGGAGGAGGACGGTGG + Intergenic
1161370622 19:3908902-3908924 GAGGATGGGGAGGAGGAGGATGG - Intronic
1161389257 19:4012722-4012744 TTTGATGAGGAGGAGGGAGGGGG + Intronic
1161420310 19:4173061-4173083 TTTGGTGTGGAGGCGGAGTCTGG + Intergenic
1161589380 19:5122228-5122250 GTGGCTGTGAAGGAGGAGGAAGG - Intronic
1161915663 19:7225995-7226017 TTTGATGTGGTGGAGGAGAGGGG - Intronic
1162132454 19:8535337-8535359 TTTGATTTGGAGAAGACGGACGG - Intronic
1162156574 19:8682237-8682259 TATGATCTGGAGGATGAGGATGG + Intergenic
1162183023 19:8883530-8883552 TTAGCTGTGGAGGAGGAAGAGGG + Exonic
1162373041 19:10290265-10290287 TGTGTTGGGGAGGAGGGGGAAGG - Intronic
1162771606 19:12952758-12952780 TCAGATGTGGAGGGGGAGGTGGG + Exonic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1162985154 19:14265222-14265244 GTTGGTGTGGAAGAGGAAGAGGG + Intergenic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1164249610 19:23465629-23465651 TAGGAGGTGGAAGAGGAGGAGGG - Intergenic
1164249999 19:23467971-23467993 GGAGAAGTGGAGGAGGAGGATGG - Intergenic
1164511013 19:28897268-28897290 TGTGATGGGGAGGCTGAGGAAGG - Intergenic
1164718973 19:30417431-30417453 TTTGAGGTGGCAGAGAAGGAGGG + Intronic
1164738549 19:30560040-30560062 GATGATGAGGAGGAGGTGGATGG - Intronic
1164850259 19:31477327-31477349 TTTGATGTGGAGGGTGAGGCAGG - Intergenic
1165339402 19:35200015-35200037 TTTGATTTGGGGGAAGAGCAGGG + Intergenic
1165379990 19:35472413-35472435 TTAGATATGGAGGAAGAAGAAGG - Intergenic
1165714514 19:38035772-38035794 GATAATGAGGAGGAGGAGGATGG + Intronic
1165866517 19:38942793-38942815 GTTGAAGTGGAGGAAGAGAAGGG - Intronic
1165985227 19:39762832-39762854 TTTGATGTTGTGGTGGGGGAGGG - Intergenic
1166085634 19:40472812-40472834 TGGGATGAGGAGGAGGGGGAAGG + Intronic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1166567932 19:43776447-43776469 TCAGATCAGGAGGAGGAGGAGGG + Intronic
1166672445 19:44719004-44719026 GAGGAGGTGGAGGAGGAGGAGGG + Intergenic
1166730705 19:45057579-45057601 TCAGATGTGGAGGAAGAGGGAGG + Intronic
1166858259 19:45794123-45794145 GTTGATGTGGGGGTGGGGGAAGG - Intergenic
1167040781 19:47021394-47021416 TCTGGTGGGAAGGAGGAGGAAGG - Intronic
1167050575 19:47075448-47075470 ACTGAAGAGGAGGAGGAGGAGGG - Intronic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167401050 19:49269696-49269718 TCTGAGGGAGAGGAGGAGGAAGG - Intergenic
1167497137 19:49826355-49826377 TTTGATGGCTAGGAAGAGGAGGG + Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168251582 19:55145343-55145365 GAGGAAGTGGAGGAGGAGGAGGG + Intronic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925662458 2:6217421-6217443 TGTGAGGTGGAGGAGGGAGAGGG - Intergenic
925746917 2:7051321-7051343 TTGGAGGTGGAGCAGGTGGACGG + Intronic
925981663 2:9182050-9182072 TTGGATGTGGAGCAGAGGGAAGG + Intergenic
926377077 2:12241554-12241576 TCTGAGGAGGAGGAGGAAGAGGG + Intergenic
926446466 2:12948511-12948533 TGTGATCTGGAGCAGGAGGAGGG + Intergenic
926582917 2:14651048-14651070 TATGATGAGGATGAGCAGGATGG - Intergenic
926867515 2:17375945-17375967 TATATTTTGGAGGAGGAGGAAGG - Intergenic
926907603 2:17820724-17820746 TTTGTGTTGGAGAAGGAGGAGGG + Intergenic
926919912 2:17930167-17930189 TGTGATGGGAAGGAGGAGGTGGG + Intronic
927157437 2:20229147-20229169 TTTGTTTTGGAGGAGGAGAGTGG + Intergenic
928624309 2:33123742-33123764 ATAGATGAGGAGGAGGAGGGTGG - Intronic
928904855 2:36357158-36357180 TTATCTGCGGAGGAGGAGGAAGG - Intronic
929437412 2:41939191-41939213 GATGATGAGGAAGAGGAGGAGGG - Intronic
929889996 2:45910936-45910958 TTGGGTGTGTAGGAGGAGAATGG + Intronic
930004290 2:46883540-46883562 TTTGATGAGGAGGAGGATGCAGG + Intergenic
930019892 2:46995168-46995190 GCTGATGAGGAGGAGCAGGAGGG - Exonic
930151634 2:48066154-48066176 TCTGCTGTGGAGGAGGTGGGTGG + Intergenic
931476005 2:62588137-62588159 TTTGAAGATGAGGAGGAGGAGGG + Intergenic
932138596 2:69254993-69255015 TTTGTGGGAGAGGAGGAGGATGG - Intergenic
932305035 2:70695964-70695986 TTTTATTTGGAGCAGGAGAAAGG + Intronic
932496192 2:72147052-72147074 TTTGTGGTGGAAGAGGAAGAAGG - Intronic
932669926 2:73728505-73728527 GTGAATGTGGAGGAGGAAGACGG + Intergenic
932758612 2:74425398-74425420 GTAGCTGTGGAGGAGGAAGAGGG - Exonic
932889549 2:75580067-75580089 AATGATATGGAAGAGGAGGAAGG + Intergenic
933367986 2:81378873-81378895 TTTGAGGAGGAGGAAGAAGAGGG - Intergenic
933481017 2:82857326-82857348 TTTGATGTCCAGGAGGAGAAAGG + Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934637806 2:96007048-96007070 TTTTATGGGGAGGGGGAGAATGG - Intergenic
934795854 2:97098363-97098385 TTTTATGGGGAGGGGGAGAATGG + Intergenic
935053461 2:99544253-99544275 TGTGATGATGAGGAGGAGGATGG + Intergenic
935453606 2:103239414-103239436 TTTGAGGTGGTGGGGGATGAGGG + Intergenic
935505263 2:103892440-103892462 TATGAATTGGAGGAGGGGGAGGG + Intergenic
935796329 2:106644797-106644819 ATTGCTGTGGAGTAGGAGGTAGG + Intergenic
935854958 2:107263759-107263781 GTGGATGTGGGGGAGGAGGGTGG + Intergenic
936087717 2:109480625-109480647 TGGGAGGAGGAGGAGGAGGATGG + Intronic
936964131 2:118110435-118110457 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
937836136 2:126471953-126471975 TCTGATGGGGAAGATGAGGATGG - Intergenic
937986995 2:127642461-127642483 TCTGGTTTGGAGGAGGAGGGGGG - Intronic
938116655 2:128607004-128607026 TTTGCTGTCGCGGAGGAAGAGGG - Intergenic
938221942 2:129576573-129576595 CTTGCAGAGGAGGAGGAGGAGGG - Intergenic
938222119 2:129578539-129578561 ATTGCTGCGGAGAAGGAGGAAGG + Intergenic
938693912 2:133817693-133817715 GTGGATGTGGAGGTGTAGGAGGG + Intergenic
939099485 2:137879949-137879971 CTTGAGGTGGTGGGGGAGGAGGG - Intergenic
939434060 2:142150622-142150644 AATGATGAGGAGGAGGAGAAGGG - Intergenic
939539180 2:143472703-143472725 AATGATGAAGAGGAGGAGGAAGG + Intronic
939570278 2:143832479-143832501 TTTGCTGGGGTGAAGGAGGAGGG + Intergenic
940461083 2:153964034-153964056 TTTGGTGTAGAGGGTGAGGAGGG + Intronic
940852205 2:158699156-158699178 GATGAGGAGGAGGAGGAGGAAGG + Intergenic
940867218 2:158829474-158829496 TTTGATATGGAGGATGAATACGG + Intronic
940972327 2:159907157-159907179 TGTTTTGAGGAGGAGGAGGAAGG + Intergenic
941249342 2:163143620-163143642 TTTGCAGTGGAGGAGGAACATGG + Intergenic
941888134 2:170550805-170550827 TTTGCTGTGCAGGAAGAGGGTGG + Intronic
942227831 2:173832208-173832230 TTCCATGTGGAGTAGGCGGATGG - Intergenic
942899944 2:181103344-181103366 TATGCCCTGGAGGAGGAGGAAGG - Intergenic
943124490 2:183779691-183779713 TTTGCTATTGTGGAGGAGGAAGG + Intergenic
943605037 2:189967152-189967174 TTTGGTTTATAGGAGGAGGAAGG - Intronic
944535535 2:200705886-200705908 TGAGATGTGGAGGGGGAGGCAGG - Intergenic
944822050 2:203441032-203441054 TTGGGGGTGGAGGAGGGGGAGGG + Exonic
944915603 2:204357491-204357513 TTTCGTGAGGAGGAGGAGGTGGG + Intergenic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945130025 2:206561007-206561029 TTTGATTTCTTGGAGGAGGATGG + Intronic
945606133 2:211934560-211934582 TTTTTTGTGGATGAGGTGGAAGG - Intronic
945614708 2:212053417-212053439 TATGAGGTGGCAGAGGAGGAAGG - Intronic
946846646 2:223864901-223864923 GAAGAAGTGGAGGAGGAGGAGGG - Intronic
947119374 2:226799661-226799683 TCCGAGGAGGAGGAGGAGGAGGG - Exonic
947698258 2:232211108-232211130 GGGGAGGTGGAGGAGGAGGAGGG - Intronic
947771080 2:232670522-232670544 TTGAATCTGGAGGAGGAGGGTGG + Intronic
947836605 2:233180411-233180433 TTTGCTGTGGCAGTGGAGGAGGG - Intronic
947901095 2:233722941-233722963 TGGGCTGAGGAGGAGGAGGAAGG + Intronic
948532472 2:238618653-238618675 TTCTCTGTGGAGGCGGAGGAGGG + Intergenic
948565516 2:238883949-238883971 TTTAATGCAGAGGAGAAGGAAGG - Intronic
948648700 2:239425430-239425452 TTTTATGGGGTGGGGGAGGAGGG + Intergenic
948969492 2:241414087-241414109 TGTGCTGTGGTAGAGGAGGAGGG + Intronic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169554559 20:6735728-6735750 ACTGATGAGGAGGAGGAGCAGGG + Intergenic
1169601029 20:7261062-7261084 TGTGGTGTGGGGGAGGGGGAAGG - Intergenic
1169855890 20:10102312-10102334 TAGGATGAGGAGGAAGAGGAGGG - Intergenic
1170602436 20:17851130-17851152 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1170793154 20:19524339-19524361 TTTGCTGTGGATGTCGAGGAGGG - Intronic
1170934892 20:20800905-20800927 TTTGCTGTGGATAAGCAGGATGG + Intergenic
1171024386 20:21615505-21615527 TTTGTTGAAGAGGAGAAGGATGG + Intergenic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171120324 20:22562889-22562911 TTTCTTTTGGAGGAGGAGGTAGG - Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171752484 20:29065343-29065365 TTTGAAGTGGAGGAGGGTGAAGG + Intergenic
1171789788 20:29512235-29512257 TTTGAAGTGGAGGAGGGTGAAGG - Intergenic
1172189772 20:33054853-33054875 TTTGGGGTGGAGGTGGGGGAAGG + Intergenic
1172439776 20:34957128-34957150 TTTGGTGTGGATAATGAGGAAGG + Intergenic
1172448313 20:35004485-35004507 GTTGATGAGGCGGAAGAGGAAGG + Exonic
1173001567 20:39109508-39109530 TTCAATGTGCGGGAGGAGGAGGG + Intergenic
1173045329 20:39504271-39504293 ATTAATGTGGAGGAGGAGATTGG - Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1174776083 20:53344200-53344222 GATGATGATGAGGAGGAGGAGGG - Intronic
1174933084 20:54836941-54836963 TTTGATTTGGAGGGGGGTGAGGG - Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1176951510 21:15052416-15052438 TTTGATGTGTGGGAGGGGAAAGG - Intronic
1178274138 21:31221024-31221046 TTTTTAGTGGGGGAGGAGGAAGG - Intronic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178610768 21:34077077-34077099 TTTGAGGTAGATGAGGAGAAGGG + Intronic
1178717929 21:34983841-34983863 TTTGGTGTGGGGGTGGAGCAGGG + Intronic
1178787391 21:35666414-35666436 CTTGGTGTGAAGGAGGAGGAAGG - Intronic
1178932558 21:36832254-36832276 GCTGATGAGGAGGAAGAGGATGG + Intronic
1179009553 21:37545834-37545856 TTTGAGGTAGGGGAGGAGTACGG + Intergenic
1179028672 21:37701266-37701288 TTTGAATTGCAGGTGGAGGAAGG + Intronic
1179081821 21:38178602-38178624 GTGGCGGTGGAGGAGGAGGAGGG + Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179772483 21:43632600-43632622 GTAGAGGTGGAGGAGGTGGAAGG - Intronic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1180390481 22:12277346-12277368 TTTGAAGTGGAGGAGGGTGAAGG - Intergenic
1180409262 22:12587411-12587433 TTTGAAGTGGAGGAGGGTGAAGG + Intergenic
1180920264 22:19518110-19518132 TGTGATGTGGGAGAGGTGGATGG + Intronic
1181341364 22:22182427-22182449 TCTGCAGTGGTGGAGGAGGAGGG - Intergenic
1181357004 22:22304040-22304062 TTTGATGTGGAATATGATGAAGG + Intergenic
1181554127 22:23657865-23657887 GAGGAGGTGGAGGAGGAGGAGGG - Intergenic
1181886074 22:26023476-26023498 GTAGAGGAGGAGGAGGAGGAGGG - Intronic
1182913706 22:34008802-34008824 TTCAAGGGGGAGGAGGAGGATGG - Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183461984 22:37956792-37956814 GATGATGTGGAGGAGGATGAAGG + Exonic
1183551075 22:38485937-38485959 ATTTACGTGAAGGAGGAGGAGGG + Exonic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183929875 22:41229870-41229892 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1184731410 22:46373016-46373038 GTAGATGTAGTGGAGGAGGATGG + Exonic
1184764078 22:46562428-46562450 CTTCATGGGGAGGTGGAGGAAGG + Intergenic
1184965251 22:47966664-47966686 GTTGCTGTGGAGGAGAAGGAAGG - Intergenic
1185128072 22:49022741-49022763 CTTGGTGTGGAGAAAGAGGAGGG + Intergenic
949396108 3:3616076-3616098 CTAGATGTGGAGAAAGAGGAGGG + Intergenic
949741604 3:7240698-7240720 CTTCATGTGGAAGAGGGGGAGGG - Intronic
950106747 3:10393357-10393379 TTTTGGGTGGAGGGGGAGGAAGG + Intronic
950167627 3:10813820-10813842 TATTGTGAGGAGGAGGAGGATGG - Intergenic
950167643 3:10813909-10813931 TATTGTGAGGAGGAGGAGGATGG - Intergenic
950201994 3:11050984-11051006 TCTGGTATTGAGGAGGAGGAGGG - Intergenic
950399325 3:12758627-12758649 TTTGAGCTGGAGGCAGAGGACGG + Intronic
950540125 3:13607428-13607450 TAGGAGGGGGAGGAGGAGGAGGG + Intronic
951126107 3:18985467-18985489 TTGGATGTGGGGCAGGAGGGAGG - Intergenic
952205255 3:31174933-31174955 ATTGAGGTGGAGGAAAAGGAGGG - Intergenic
952282722 3:31938996-31939018 GTTGATCTGAAGCAGGAGGAAGG - Intronic
952286780 3:31977220-31977242 TTTGATGTGGAGGTGAGAGAGGG - Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953016302 3:39080105-39080127 TTGGAGGTGGAGGAGGGGGCAGG + Intronic
953187411 3:40651753-40651775 TTTGATGCTGAGGAGGAGAGGGG - Intergenic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953543086 3:43839909-43839931 TTTGATGAGGAGGAGGCAGGAGG + Intergenic
953877530 3:46674850-46674872 TTTTCTGGGGAGGAGGAGGCTGG - Intronic
953999863 3:47547509-47547531 CTGGATGTGGAGGCGGAGGCAGG - Intergenic
954000106 3:47549898-47549920 TGGGAGGGGGAGGAGGAGGAAGG - Intergenic
954707222 3:52487470-52487492 CCAGACGTGGAGGAGGAGGAGGG + Exonic
954770652 3:52965149-52965171 TTTGAGCTGGAGAAGGAAGAGGG - Intronic
954785202 3:53087487-53087509 TTTGATGTTGAGGAAGAGACAGG - Intronic
954996768 3:54888999-54889021 TCTAAAGTGGAGGAGGAAGATGG + Intronic
955190484 3:56756927-56756949 ATTGCTCTGGGGGAGGAGGATGG - Intronic
955499573 3:59570550-59570572 TATGATGTGATGGAGGAGCAGGG - Intergenic
955516305 3:59729755-59729777 ATTGGTGTGGGGGATGAGGAGGG - Intergenic
956478623 3:69650504-69650526 GATGATGTTGATGAGGAGGAAGG - Intergenic
957037154 3:75304357-75304379 TTTGGTTTGGAGATGGAGGAAGG + Intergenic
957413312 3:79868301-79868323 TGTGATGTGGAGGAGAGAGAAGG - Intergenic
958152660 3:89710636-89710658 TTTGATGCAGAAGAGGAGGTTGG + Intergenic
958475069 3:94569748-94569770 GTTGAAGTGGAGGAGGAGCCTGG + Intergenic
960047388 3:113211478-113211500 TGCGAGGAGGAGGAGGAGGAGGG - Exonic
960371480 3:116846330-116846352 GTTGATGTGGAGGAGGGGAGAGG + Intronic
960488565 3:118282347-118282369 TCTGAGGAGGAGGAGGAGCATGG - Intergenic
960629232 3:119712143-119712165 TTTGAGGTTGGGGAGGAGGTGGG + Intronic
961030581 3:123600054-123600076 TAGGAAGGGGAGGAGGAGGAAGG - Intergenic
961048001 3:123722504-123722526 TGTGTGGTGGAGGAGGAAGACGG + Intronic
962069677 3:132020333-132020355 TCTGATGTGGAGGCTGAGGCTGG + Intronic
962103474 3:132366595-132366617 TTTGGTGTGGGGAATGAGGATGG + Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
963259593 3:143178667-143178689 TTTGATGTGGAGGCAGTGAAGGG + Intergenic
963295429 3:143541068-143541090 TTTGAAGTGGTGGTGGGGGAAGG - Intronic
964281584 3:155072241-155072263 ATTGATGGGAATGAGGAGGATGG - Intronic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
965731575 3:171777692-171777714 TTTACTGTCGAGGAGGGGGAAGG - Intronic
965770462 3:172176535-172176557 TTTCATGTACAGGAAGAGGAAGG + Intronic
965794383 3:172424153-172424175 TGAGATGAGGAGGTGGAGGATGG + Intergenic
966141288 3:176759399-176759421 TTCCAACTGGAGGAGGAGGATGG + Intergenic
966482357 3:180425051-180425073 TGTGGGGTGGAGGAGGAGGGAGG - Intergenic
966666280 3:182474815-182474837 TATGATTTGGAGGATCAGGAAGG + Intergenic
966908531 3:184544637-184544659 TAGGAGGGGGAGGAGGAGGAGGG - Intronic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
966961398 3:184943158-184943180 TTTGATGGGGAAATGGAGGAAGG - Intronic
967109083 3:186277473-186277495 TGTGAGGTAGAGGAGCAGGATGG - Intronic
967413268 3:189188524-189188546 AGTGATGTGGAGGAGGAAAAGGG - Intronic
967829790 3:193909235-193909257 GTCCATGTGGAGGAGAAGGACGG + Intergenic
967931455 3:194693374-194693396 TGTGAACTGGAGAAGGAGGAAGG - Intergenic
967977971 3:195045968-195045990 ATGGAGGTGGAGGAGGAGAACGG - Intergenic
967983375 3:195078535-195078557 TTGGATGGGGATGAGGAAGAGGG - Intronic
967992522 3:195142140-195142162 CTTGATGTGGTGGAGCAGGGAGG - Intronic
968571454 4:1344047-1344069 TTTTGGGTGGAGGGGGAGGAGGG + Intergenic
968811051 4:2799811-2799833 CTTGAGGGGGAGCAGGAGGAGGG + Intronic
968939909 4:3632372-3632394 TTTCCAGTGGAGAAGGAGGAGGG + Intergenic
969144584 4:5111118-5111140 GTTGATGTGGACGTGGAGAAAGG + Intronic
969167381 4:5328859-5328881 TTTGTTGAGGGGGAGGAGCATGG + Intronic
969547814 4:7843290-7843312 TATGATGAAGAGGAGGAGGATGG - Exonic
970113926 4:12671431-12671453 TTGGCTGAGGAGGAGGAGGAGGG + Intergenic
970827308 4:20291367-20291389 TTGGCTGAGGAGGAGGAGAATGG + Intronic
970898185 4:21127529-21127551 TCTGATGGGGTGGAGGAGGTTGG - Intronic
971237738 4:24857930-24857952 TTTGGAGTTGAGGAGGTGGAGGG - Intronic
971671756 4:29567451-29567473 GTTGATGATAAGGAGGAGGAAGG + Intergenic
971754740 4:30692891-30692913 GATGAGGAGGAGGAGGAGGAGGG - Intergenic
972866196 4:43236068-43236090 TTTAATGTGCAGGAGCAGAAAGG - Intergenic
973158779 4:46991478-46991500 TGTGATGTGAAGTAGGAGTATGG - Intronic
973267797 4:48228840-48228862 TGAGATGTGGAGGAGCAGGATGG - Intronic
973302991 4:48610381-48610403 TTATATGTGGTGGAGGAGTAGGG - Intronic
973536752 4:51890683-51890705 TTTGAGGTAGATGAGAAGGAAGG + Intronic
973543043 4:51953538-51953560 TTTGAAGTGGAGAAATAGGATGG + Intergenic
973588150 4:52412882-52412904 TGTGATAGTGAGGAGGAGGATGG - Intergenic
973694833 4:53480347-53480369 TTTCATGATGAGGAGGTGGAAGG + Intronic
974070592 4:57119732-57119754 TGAGATGTGAAGGATGAGGAAGG - Intergenic
975380995 4:73700581-73700603 TTTCATGTGGAAGAAAAGGAAGG + Intergenic
975949901 4:79757479-79757501 TCTGATGGGGTGGCGGAGGACGG - Intergenic
976003415 4:80399689-80399711 TTTGAGGTGGGGGAGGGGGGAGG + Intronic
976376733 4:84353841-84353863 TTTGGTGTGGAGATGGAGGTTGG - Intergenic
976499176 4:85767487-85767509 ATTGCTGTGGAAGAGGAAGAGGG + Intronic
976666157 4:87594902-87594924 TTTTTTCTGGAGGTGGAGGAGGG + Intergenic
977216508 4:94291328-94291350 TTTTAAGGGTAGGAGGAGGAAGG - Intergenic
977913735 4:102566630-102566652 TTTGATGAGGATGCAGAGGAAGG + Intronic
978011782 4:103695309-103695331 GGTGAAGTGGAGGAGGTGGAAGG - Intronic
978514134 4:109553337-109553359 GATAATGAGGAGGAGGAGGAAGG - Intergenic
978662134 4:111138804-111138826 TTTGAGGTGGCAGAGGAAGATGG - Intergenic
979606914 4:122648316-122648338 TTTGTTTTGGATGGGGAGGAAGG - Intergenic
979711229 4:123781829-123781851 TCTGATCTTTAGGAGGAGGAAGG + Intergenic
979791488 4:124787512-124787534 TTTGATGTGGCAAAGGAAGAAGG - Intergenic
980950278 4:139368708-139368730 TTTGAGGTGGCGGGGGTGGAGGG + Intronic
981740610 4:147997566-147997588 TTGGATGTGGAGGACAAAGATGG + Intronic
981989992 4:150907174-150907196 ACTGATGTGGAGGAGGAGATTGG - Intronic
982117750 4:152112260-152112282 AATGGGGTGGAGGAGGAGGAGGG - Intergenic
982215658 4:153080723-153080745 TTGGATGAGGAGGTGCAGGAGGG - Intergenic
982495898 4:156091832-156091854 GTGGGTGTGGAGGATGAGGAGGG + Intergenic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983647884 4:170010465-170010487 GTGGATGTGGAAGAGGGGGAAGG - Intronic
983913872 4:173269722-173269744 GTTGAGGAGGAGGAGGAGGAGGG - Intronic
984902669 4:184599128-184599150 TTTGTTGGGGAGGAAGAGAAGGG + Intergenic
985223390 4:187732042-187732064 GCTGAGGGGGAGGAGGAGGACGG - Intergenic
986273545 5:6254192-6254214 TTTGAAGGGGAGGAGGATCAGGG - Intergenic
986399736 5:7369166-7369188 TGTGGTGGGGAGGAGGAAGAGGG + Intergenic
986534424 5:8772192-8772214 TAGGATTTTGAGGAGGAGGAAGG + Intergenic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
987375767 5:17232725-17232747 TTTTTTTTGGAGGAGGAGGTGGG + Intronic
987505030 5:18757681-18757703 TCTGAGGAGGAGGAAGAGGAGGG + Intergenic
988497723 5:31758975-31758997 ATGGAGGTGGAAGAGGAGGAGGG - Intronic
988601185 5:32640794-32640816 CTAGATTTGGAGGAGGAGGTCGG + Intergenic
988660462 5:33261582-33261604 TTGGAGGAGGAGGAGGAGGTGGG + Intergenic
988775848 5:34477570-34477592 ATTGATGTGGAGGATTAAGAGGG + Intergenic
989464516 5:41739463-41739485 TTTGATGTGGACAAGAAGAAAGG - Exonic
990120182 5:52442030-52442052 ATTGATATGATGGAGGAGGAGGG - Intergenic
990505136 5:56436508-56436530 TTTTATGTGGTGGGGTAGGAGGG - Intergenic
990526975 5:56637648-56637670 ATGGCTTTGGAGGAGGAGGAGGG + Intergenic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
991497095 5:67237242-67237264 TTAGATGAGGTGGCGGAGGAAGG + Intergenic
992090760 5:73314144-73314166 GTGGATGTGGAGGAGGAGGTGGG - Intergenic
992130417 5:73686302-73686324 TTTGAGGTAGGGGAGGAGGGTGG - Intronic
992201011 5:74383977-74383999 GTGGATGAGGAGGAGAAGGAGGG + Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992834749 5:80629127-80629149 TCTGATGTCCAGGAGGAGAAAGG - Exonic
993227852 5:85191434-85191456 TTTGCTGTGGAGAAACAGGAGGG - Intergenic
993316369 5:86411356-86411378 TCTGATGTGGAGAAATAGGAAGG - Intergenic
993401514 5:87458511-87458533 CTTGAAGTGAAGGAAGAGGATGG - Intergenic
993909854 5:93667925-93667947 TTGGATGTGAAGGAGGAGTAAGG + Intronic
994850273 5:105046317-105046339 GTCGAGGAGGAGGAGGAGGAGGG - Intergenic
994970177 5:106727651-106727673 GTTGATGTGGAGGGTGAGGCAGG - Intergenic
995055202 5:107751809-107751831 GGTGATGCAGAGGAGGAGGAAGG + Intergenic
995404312 5:111776988-111777010 GATGAGGAGGAGGAGGAGGAAGG + Intronic
995806090 5:116053662-116053684 TTTGATGTGGGTAAGGATGAAGG - Intronic
996504098 5:124249956-124249978 TAAGATATGGAGGAGGAAGATGG - Intergenic
997373755 5:133382444-133382466 TGAGAGGAGGAGGAGGAGGAGGG - Intronic
997423218 5:133785610-133785632 TATGAAGAGGAGGAGGAAGAAGG + Intergenic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
997745830 5:136299374-136299396 TGTGTGGTGGAGGAGGAGGAGGG + Intronic
998561371 5:143174996-143175018 TTTGATGTGGAGCTACAGGAAGG + Intronic
998610784 5:143685856-143685878 TTAGAGGAGTAGGAGGAGGATGG + Intergenic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998820020 5:146049730-146049752 TTGGGTGTGGAGGAAGAGGTAGG - Intronic
998960786 5:147484242-147484264 TTTGGTGAAGGGGAGGAGGATGG - Intronic
999134274 5:149307440-149307462 TACGATGAAGAGGAGGAGGAAGG + Exonic
999241025 5:150127422-150127444 ATGGATGGGGAGGAGGAGGTGGG - Intronic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999623880 5:153499826-153499848 TTGGTTGTGGAGTGGGAGGAGGG + Intronic
999682771 5:154075395-154075417 TCTGACGTGGAGGATGGGGAAGG - Intronic
999684258 5:154088422-154088444 TCTGGTGTGGAGAAGGAGGGGGG - Intronic
1000592593 5:163176557-163176579 CCTGATGTGAAAGAGGAGGAGGG + Intergenic
1000810119 5:165851040-165851062 TTTTATGTGGAAGAGGTGGAAGG - Intergenic
1001056448 5:168454017-168454039 GAGGAGGTGGAGGAGGAGGAGGG + Exonic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600113 5:172923131-172923153 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600127 5:172923190-172923212 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001669704 5:173463525-173463547 TTTGATGAGGAGGTTCAGGAAGG + Intergenic
1001820811 5:174708807-174708829 TTTGAGGAGGAGGAGGAGGCGGG - Intergenic
1002095410 5:176828072-176828094 GTGGGTGTGGAGGAGGGGGAAGG - Intronic
1002352339 5:178591862-178591884 CTTGACCTGGAGGATGAGGAGGG - Intergenic
1002857974 6:1055119-1055141 TTCCATGTGGAGGGGGAGGGTGG + Intergenic
1003122278 6:3328422-3328444 CTTTATGTGACGGAGGAGGAAGG + Intronic
1003125111 6:3349533-3349555 TGTGAGGAGGTGGAGGAGGAAGG - Intronic
1003556772 6:7146776-7146798 TTTGGTGGGGAGGAGGTGGTGGG + Intronic
1003980417 6:11384668-11384690 TATGGAGTGGAGGATGAGGATGG + Intergenic
1004043047 6:12001063-12001085 TTTGATTTGGGGGAGCAGGATGG - Intergenic
1004100125 6:12600822-12600844 TTTGATGCAGAGGAGGAAAATGG + Intergenic
1004396321 6:15248780-15248802 TTTGACGTCACGGAGGAGGAGGG - Intronic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004876428 6:19959652-19959674 TTTGAGGTGGAAAAGGAGCAGGG - Intergenic
1004890136 6:20093107-20093129 TTTGATGGGGCTGAGAAGGAAGG + Intergenic
1005009569 6:21322976-21322998 TTTTCTGAGGAGGAGGAGGGAGG + Intergenic
1005504615 6:26458677-26458699 GCTGAGGAGGAGGAGGAGGAGGG - Exonic
1005623294 6:27639687-27639709 TTGGATGTGGATGATGAGAAGGG + Intergenic
1005914752 6:30342401-30342423 TTTTGTGTGGAGGGGGAGGTAGG + Exonic
1006167783 6:32075346-32075368 TTTGTGGTGGAGTTGGAGGAGGG - Intronic
1006186674 6:32185313-32185335 TTTGATGTGGAGGCAGTGAAGGG - Exonic
1006312613 6:33271593-33271615 TCAGATATGGAGGAGGAAGAGGG - Exonic
1006428009 6:33978153-33978175 TTATTTGTGAAGGAGGAGGAAGG + Intergenic
1007563692 6:42831676-42831698 CTGAATGTGGAGGAGGAGAAAGG - Intronic
1007596106 6:43052371-43052393 TGTGAAGTAGAGGAGCAGGAGGG + Exonic
1008871397 6:56276566-56276588 TCTGATGTCCAGGAGGAGAAAGG - Intronic
1009333902 6:62460980-62461002 TCTGATGTGGAGGAGGAGAAAGG - Intergenic
1009866619 6:69406111-69406133 TTTGTTGAGGAAGAGAAGGATGG - Intergenic
1010232218 6:73545113-73545135 TAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1010632356 6:78213191-78213213 AATTAGGTGGAGGAGGAGGAAGG - Intergenic
1011229505 6:85144411-85144433 TTTGAGGTGATGGTGGAGGAAGG - Intergenic
1011737874 6:90330986-90331008 CTTGGTGGGGAGGAGGAGGATGG + Intergenic
1012561826 6:100590592-100590614 TTTGATGTGGATGGGGAAAAGGG - Intronic
1013000857 6:106020690-106020712 TTTGATAAAGGGGAGGAGGAAGG + Intergenic
1013366758 6:109442931-109442953 TAGGATGTGGGGGAGAAGGAGGG - Intronic
1014143291 6:117968426-117968448 TTGGATGTTGAGGAGCAGTAGGG + Intronic
1014269006 6:119314825-119314847 GCCGAAGTGGAGGAGGAGGAAGG - Intronic
1014528062 6:122524164-122524186 GATGAAGAGGAGGAGGAGGAAGG - Intronic
1014755967 6:125302090-125302112 TTGGAAGGGGAGGAGGAAGAGGG - Intergenic
1015000577 6:128209542-128209564 TTTAATGTGTAGAATGAGGAGGG - Intronic
1015055960 6:128903814-128903836 TCTGCTGTGGAGGATGGGGAAGG + Intronic
1015181988 6:130370401-130370423 TGGGATGAGGAGGAGGAGGCTGG + Intronic
1015256488 6:131184227-131184249 TGTGAAGGAGAGGAGGAGGAAGG + Intronic
1015391721 6:132689999-132690021 TTTGATGTGGAACAGGAAAACGG - Intronic
1015500332 6:133925650-133925672 TTTGATGTGATGCAGGGGGATGG - Intergenic
1016326810 6:142912420-142912442 TGTGATGAGGAGAAGGGGGAAGG - Intronic
1016556960 6:145349688-145349710 GTTGAGGTGGAGGTGGAGGAGGG - Intergenic
1016733938 6:147455627-147455649 TCTGTTATGGAGGAGGAGGAAGG + Intergenic
1016915643 6:149242000-149242022 TTTGATGGGGAGAATGAGGGAGG - Intronic
1017235823 6:152116917-152116939 TTTGAGTTAGTGGAGGAGGATGG + Intronic
1017382083 6:153843022-153843044 TTAAATGTAGAGGAAGAGGAGGG - Intergenic
1018027738 6:159818983-159819005 TTTGACGCTGAGGATGAGGATGG - Exonic
1018220205 6:161570501-161570523 GTGGCTGAGGAGGAGGAGGAGGG - Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018496450 6:164351300-164351322 TTTGATGCTGGTGAGGAGGAGGG - Intergenic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1018600295 6:165531011-165531033 TCCCATGTAGAGGAGGAGGATGG - Intronic
1018601808 6:165552130-165552152 CTTGAAGTGTAGGAGGAGGAGGG - Intronic
1018764459 6:166922377-166922399 TTTGATGGGGAGCCGGGGGATGG - Intronic
1018996554 6:168714716-168714738 GATGGTGGGGAGGAGGAGGATGG + Intergenic
1018996661 6:168715413-168715435 GATGATGGCGAGGAGGAGGATGG + Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1018996743 6:168715985-168716007 TATGAGGATGAGGAGGAGGATGG + Intergenic
1019196544 6:170286586-170286608 TGGGAAGTGGGGGAGGAGGAGGG - Intronic
1019282198 7:206152-206174 TGGGATGTGGAGCAGGGGGACGG - Intronic
1019776108 7:2912983-2913005 GGTGATGGGGAGGAGGAGGAGGG + Intronic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1020026829 7:4905398-4905420 GAGGAAGTGGAGGAGGAGGAGGG + Intergenic
1020674980 7:11172123-11172145 TTCGATGGGGTGGGGGAGGAGGG + Intergenic
1022269352 7:28791034-28791056 TTTGATGTGGTAGATAAGGAAGG - Intronic
1022359773 7:29646844-29646866 TTGGAGGTGGAGGAGAATGATGG - Intergenic
1022368575 7:29749501-29749523 TTGGAGGTGGAGGAGAATGATGG - Intergenic
1022387373 7:29914412-29914434 TTTGGGGGGGTGGAGGAGGAAGG + Intronic
1022865810 7:34418686-34418708 TTTGTCCTGGAGGAGGAGAAGGG - Intergenic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1023483321 7:40658482-40658504 CTTGATGAGGATGAGGAGAAGGG - Intronic
1023525945 7:41103331-41103353 TTTGAAATGGAGTAGAAGGAAGG - Intergenic
1024164332 7:46715239-46715261 CTTGAGGTTGAGGAAGAGGAGGG - Intronic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024353974 7:48395606-48395628 GCTGAGGAGGAGGAGGAGGAAGG - Intronic
1024524847 7:50339254-50339276 TGTGTTGTGGAGGAGGAGCTGGG + Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024720926 7:52136935-52136957 TATGAAGAGGAGGAGGAGGGAGG + Intergenic
1024872779 7:53984944-53984966 TGTGAGGGGGAGGAGGAGAATGG + Intergenic
1025640301 7:63360986-63361008 TTTGATGTTGGGGAGGAATAAGG - Intergenic
1025642398 7:63387107-63387129 TTTGATGTTGGGGAGGAATAAGG + Intergenic
1026025174 7:66738912-66738934 TGTGCTGAGGAGGTGGAGGAGGG - Intronic
1026148623 7:67769813-67769835 GAGGAGGTGGAGGAGGAGGAGGG - Intergenic
1026375781 7:69749412-69749434 TCTGATGAGGAAGAGGATGAGGG - Intronic
1026387121 7:69861155-69861177 TTTGATTTGTAGGAGGGGGTGGG + Intronic
1026388982 7:69880470-69880492 TATGATGATGAGGAGGAGGATGG - Intronic
1026523928 7:71138421-71138443 GTAGGTGAGGAGGAGGAGGAAGG + Intronic
1026946696 7:74320790-74320812 TGAGAAGAGGAGGAGGAGGAAGG + Intronic
1028216644 7:88140951-88140973 TTTTATGGGGAGGTGGAGGGGGG + Intronic
1028305379 7:89256800-89256822 TTTCCTCTGGAGGAGGAGGATGG + Intronic
1028478699 7:91280369-91280391 CTTGATGTGCAGGCAGAGGAGGG + Intergenic
1028984233 7:96997377-96997399 TGTGATGGGGAGCAGGAGGGAGG + Intergenic
1029160832 7:98550645-98550667 CATGGTCTGGAGGAGGAGGAAGG + Intergenic
1030416395 7:109249185-109249207 TTTGCACTGGAGGAGGAGCAAGG + Intergenic
1030863210 7:114663687-114663709 TTTGATGTGAAGAAGCAAGAAGG + Intronic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031850567 7:126858043-126858065 TTTGATGAGGAAGACTAGGAAGG - Intronic
1031983846 7:128149667-128149689 CTTGCTGGGGAGGAGGAGGTGGG + Intergenic
1032485799 7:132286581-132286603 TATGATGTGGAGGTAGAGCAGGG - Intronic
1032510929 7:132471713-132471735 TTGGAGTGGGAGGAGGAGGAGGG + Intronic
1032529831 7:132610886-132610908 TGTAATGTGGATGAGCAGGAGGG + Intronic
1032732653 7:134659200-134659222 TTGGTAGTGGAGGAGGGGGATGG - Intronic
1032982822 7:137304435-137304457 TTTGATGGGGAGGGGGAGCGGGG - Intronic
1033406909 7:141078746-141078768 TTGGAGGTGGATGTGGAGGAAGG + Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1034077393 7:148245423-148245445 GCTGATGTGGAGGAGGATGAAGG + Intronic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1034775016 7:153817955-153817977 TTTCAAGTGGAGGTGGGGGAGGG + Intergenic
1035110347 7:156476351-156476373 TTTCTTTTGGAGGAGAAGGAAGG - Intergenic
1035160337 7:156945188-156945210 TTGGAGGAGGAGGAGGGGGAGGG - Intergenic
1035174355 7:157039852-157039874 TTAGCTGTGCAGGAGTAGGATGG - Intergenic
1035520804 8:273886-273908 TTTGGGGTGGAGGGCGAGGAAGG + Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036236228 8:7041969-7041991 TATGAGGAGGAGGAGGAGGAGGG - Intergenic
1036583708 8:10102783-10102805 TGTGAGGTGGGGGAGTAGGAGGG + Intronic
1036655909 8:10677168-10677190 AATGAAGTGCAGGAGGAGGAGGG - Intronic
1036657908 8:10689847-10689869 TTTCATGTTGAAGAGGCGGAGGG + Intronic
1037916360 8:22775629-22775651 TTTGCTGGGAAGGAGGGGGACGG + Intronic
1038230647 8:25696286-25696308 TTTGGGGTGGAGGAGGTGGTGGG + Intergenic
1038775312 8:30525361-30525383 TTTATTGCGGAGGAGGAGGAAGG - Intronic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1038923812 8:32115544-32115566 GTAGCTGAGGAGGAGGAGGAAGG + Intronic
1038943377 8:32330476-32330498 AAGGATGTGGAGGAGGAAGATGG + Intronic
1039554440 8:38466688-38466710 TTTAATTTGGGGGAGGGGGAGGG + Intronic
1039734345 8:40314816-40314838 TTTGATGAGGAGGTGGACGATGG - Intergenic
1039772179 8:40698574-40698596 TTGGATGGTGAGGAGGATGAGGG + Intronic
1039838250 8:41275017-41275039 TTTTTTGAGGAGGAGGAGGGAGG + Intronic
1039984279 8:42435080-42435102 CTTGATGAGGAGGAGGAAGTGGG + Intronic
1040849233 8:51881414-51881436 TTTTCTGTGGAGGACGAAGAAGG - Intronic
1041151694 8:54942465-54942487 TCAGTTGTGGGGGAGGAGGATGG - Intergenic
1042130438 8:65582512-65582534 GGTGAGGGGGAGGAGGAGGAAGG + Intergenic
1042530929 8:69814511-69814533 TTTGATGAGGATGTGGAGAAAGG + Intronic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043288172 8:78561395-78561417 CATGATGTTGAGGAGGAAGAAGG - Intronic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044252566 8:90021342-90021364 CTAGATGTGGAGAAAGAGGAGGG + Intronic
1045126699 8:99099644-99099666 TTTAATGTTGAGGTGTAGGATGG + Intronic
1045224605 8:100232243-100232265 TTGGCTGCGGAGGAGGAGGCTGG + Intronic
1045396485 8:101765637-101765659 TATGTTGGGGAGGAGTAGGAAGG + Intronic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1046109110 8:109700354-109700376 TTGGCTGAGAAGGAGGAGGAGGG - Intergenic
1046278545 8:111993657-111993679 TTTGATGTGGCGGCGGGGGGCGG + Intergenic
1046604379 8:116354592-116354614 TCTGATGTGGGGGAGGGGGAAGG - Intergenic
1046898656 8:119500280-119500302 TTTTTTGGGGAGGAGGAGTATGG + Intergenic
1047107540 8:121749988-121750010 ATTACTGTGGGGGAGGAGGAGGG + Intergenic
1047309907 8:123683237-123683259 TGAGTTGTGGAGGAGGAGAAAGG + Intronic
1047527876 8:125649162-125649184 TGTGATGAGGAGGAGGTGGTTGG + Intergenic
1047780220 8:128105065-128105087 TTGGGTGTGGAGGAGCAGCATGG - Intergenic
1047916087 8:129585074-129585096 TTTGCTGCGGAGGGTGAGGAAGG - Intergenic
1048237852 8:132709634-132709656 TGTGCTTTGGAGGTGGAGGAGGG + Intronic
1048271321 8:133030408-133030430 GGTGATGAGGAGGAGGATGATGG + Intronic
1048274459 8:133055803-133055825 GGTGATGAGGAGGGGGAGGAAGG - Intronic
1048794600 8:138138189-138138211 TCTCCTGTGGAGGAGGAGGAGGG - Intronic
1049354486 8:142180878-142180900 TTTGATGTGGGGGAGGCAAAGGG - Intergenic
1049358997 8:142202939-142202961 GTTGATCTGGGAGAGGAGGAGGG - Intergenic
1049601811 8:143511355-143511377 TTTTATGTGGAGCAGGAGTGAGG + Intronic
1049811298 8:144574182-144574204 GATGAGGAGGAGGAGGAGGAGGG + Intronic
1050470715 9:5986594-5986616 TGTGCTGTGGAGAAGTAGGAAGG - Intronic
1051284500 9:15482445-15482467 TTTGATGTGGATGGGGCAGAAGG + Intronic
1051414585 9:16825608-16825630 CTTCCTGGGGAGGAGGAGGAGGG + Intronic
1051630667 9:19137656-19137678 TTAGATGGGGAGAAGGAGGTTGG - Intronic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1051793352 9:20834292-20834314 TCTGTTGTGGGGGAGGGGGAGGG + Intronic
1052559422 9:30065420-30065442 TATGCTGAGGAGGAAGAGGAGGG + Intergenic
1052740614 9:32388912-32388934 TTTTAATTGGGGGAGGAGGATGG - Intronic
1052764827 9:32630391-32630413 TATGATGATGAGGAGGAGGATGG - Exonic
1052807692 9:33026949-33026971 TGTTTTTTGGAGGAGGAGGAAGG + Exonic
1052985940 9:34487882-34487904 TTTGATGTGGTGGAGTAGAGAGG + Intronic
1053047125 9:34929049-34929071 TTTGACATGGAGGTGGGGGAGGG - Intergenic
1053173032 9:35904600-35904622 TGTGAGGAGGAGGAGGAGGAAGG - Intergenic
1053248241 9:36553086-36553108 TTTTTTGTGGGGGAGGGGGACGG - Intergenic
1053724033 9:40978127-40978149 TTAGAAGTGGAGGAGGGTGAAGG + Intergenic
1054341932 9:63873872-63873894 TTAGAAGTGGAGGAGGGTGAAGG - Intergenic
1054450842 9:65402903-65402925 TTTCCAGTGGAGAAGGAGGAGGG - Intergenic
1054853330 9:69871533-69871555 GGTGATGTGGAGGGGGAGAAGGG + Intronic
1054935903 9:70687252-70687274 TTTGAGGATGAGGAGCAGGAAGG + Intronic
1055416332 9:76087844-76087866 TCAGATGTGGAGGAAGAGGAGGG + Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055943173 9:81669606-81669628 TTTGGTGTGGGGGGGGAGGGTGG - Intronic
1056316822 9:85398271-85398293 TTGGATGTGGAAGTGAAGGAGGG - Intergenic
1056412044 9:86338954-86338976 TGAGAGGTGGGGGAGGAGGATGG + Intronic
1056563809 9:87756861-87756883 CTTGAGGTGGATGAGGAGCAGGG - Intergenic
1056806416 9:89732415-89732437 TTTACTGTGCAGGTGGAGGAAGG + Intergenic
1056868303 9:90251222-90251244 TGTTATGTGGAGGAAGACGATGG - Intergenic
1056905227 9:90641658-90641680 TTTGAGGAGGTGGAGGGGGAGGG - Intronic
1057608666 9:96520903-96520925 CTGGATGTGGTGGAGGAGGCAGG - Intronic
1057744776 9:97742076-97742098 GAAGATGAGGAGGAGGAGGAGGG + Intergenic
1057943256 9:99303295-99303317 TGTGCTGGGGAGGAGCAGGAAGG + Intergenic
1057952018 9:99376800-99376822 TTAGAAGTGGACCAGGAGGAAGG + Intergenic
1058041922 9:100312108-100312130 TTTGTTTTGGAGTAGGAAGATGG - Intronic
1058057375 9:100462757-100462779 TGTGATGCTTAGGAGGAGGAAGG - Intronic
1059072442 9:111152888-111152910 GTGGAGGTGGAGGAGGAGGGAGG + Intergenic
1059363808 9:113769793-113769815 TTAGATTTGGAGATGGAGGAGGG - Intergenic
1059712408 9:116881125-116881147 GTGGAAGAGGAGGAGGAGGAAGG + Intronic
1059835514 9:118147799-118147821 ATTGAGGTGGAGGTGGGGGAGGG - Intergenic
1060225304 9:121786665-121786687 GCTGATGTGGAGGATGAGCAGGG - Intergenic
1060238095 9:121880323-121880345 GTGGATGTGGAGGATGAGGGAGG - Intronic
1060452395 9:123755493-123755515 GCTGAGGTGGAAGAGGAGGAAGG - Intronic
1060504763 9:124189496-124189518 TAGGCTGGGGAGGAGGAGGAGGG + Intergenic
1060610941 9:124963881-124963903 TAGGCTGTGGAGGAGGAGGAGGG + Intronic
1061035785 9:128113715-128113737 TTCAGTGTGGAGGAGGAGGCAGG + Intergenic
1061153389 9:128842412-128842434 CATGATGTGATGGAGGAGGATGG - Intronic
1061574614 9:131498192-131498214 TTTGGGGTGGGGGAGGAGAAAGG - Exonic
1062150230 9:135014373-135014395 TTTGAGGTGCAGGTGGAGGCAGG - Intergenic
1185999270 X:4989630-4989652 GTTTATGTGGAGGAGTAGGATGG - Intergenic
1186415647 X:9381067-9381089 ATTGCTGTAGAGGAGGAGGAGGG - Intergenic
1186518497 X:10185383-10185405 TGTGGTGTGGAGGAGAGGGAGGG + Intronic
1186669648 X:11756796-11756818 TTGGATGTGAAGGAGAGGGAAGG - Intergenic
1187598141 X:20797450-20797472 TTTGATGTGGAAGGGTAGGTGGG + Intergenic
1188562997 X:31491227-31491249 TTGGATTTGGGGTAGGAGGAAGG + Intronic
1188660600 X:32753099-32753121 CTTGTTGTGGAGAAGGAAGAGGG - Intronic
1188789224 X:34387894-34387916 CTTGAAGTGGAAGAGGATGAAGG - Intergenic
1190072738 X:47292456-47292478 TTACAGGTGGAGAAGGAGGAGGG + Intergenic
1190240661 X:48655409-48655431 TTTGAAATGGAGGTGGAGGCTGG + Intergenic
1190243500 X:48676103-48676125 TTTGATCTGCAGGAGTAGGACGG - Intergenic
1190308525 X:49100872-49100894 TTTGATCTGCAGGAGTAGGACGG - Intronic
1191039848 X:56067736-56067758 TTAGAAGTGTAGGAGGGGGACGG - Intergenic
1191188176 X:57635586-57635608 TTTGGGGTGGGGGAGGGGGAGGG + Intergenic
1191641646 X:63433643-63433665 TCAGAGGAGGAGGAGGAGGAGGG + Intergenic
1191867828 X:65719816-65719838 ATGGCTGTGGAGGATGAGGAAGG + Intronic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1192343506 X:70282442-70282464 TTGGAGTTGGAGGAGGAGGGAGG + Intronic
1192477867 X:71459207-71459229 TATGATGATGAGGAGGAGGATGG + Intronic
1192478657 X:71466082-71466104 TGGGATGGGGAGGAGGGGGATGG + Intronic
1192483329 X:71503796-71503818 GTGGTAGTGGAGGAGGAGGAGGG - Intronic
1193910402 X:87298978-87299000 ATTGATGTAGAGGAAGAGAAAGG - Intergenic
1194033950 X:88847968-88847990 TCAGATGCGGAAGAGGAGGATGG - Intergenic
1194045814 X:89000990-89001012 TTTGCTGAGGTGGATGAGGATGG + Intergenic
1195160614 X:102167137-102167159 TATGATGTGTAGGAGGGGTAGGG + Intergenic
1195658098 X:107352544-107352566 GTTTTTTTGGAGGAGGAGGAAGG - Intergenic
1196025048 X:111033315-111033337 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1197984487 X:132253327-132253349 TTTGGTGGGGGAGAGGAGGAGGG + Intergenic
1198518837 X:137432516-137432538 TTTTATGTAGAGTGGGAGGATGG + Intergenic
1198936543 X:141906119-141906141 AGTAAAGTGGAGGAGGAGGAGGG - Exonic
1199074175 X:143510863-143510885 TTTGAGGTGGAGAAGGAAGGGGG - Intronic
1199093169 X:143714124-143714146 TTTGAGGTGGAGAAGGAAGGGGG - Intronic
1199215166 X:145254036-145254058 TTTGAGGTGGAGAAGGAAGGGGG + Intronic
1199220907 X:145314681-145314703 ATTGATTTGGAGGAAGAGGGTGG - Intergenic
1199373281 X:147076839-147076861 TTGGATGGGGAGTTGGAGGAGGG + Intergenic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200173182 X:154094128-154094150 TTTGATGTGGGGGTGGGGGTGGG + Intronic
1201266277 Y:12210275-12210297 ACAGATGAGGAGGAGGAGGAGGG + Intergenic
1201587062 Y:15572658-15572680 TTTGGGGTGGGGGAGGAGGGAGG + Intergenic
1202087703 Y:21155983-21156005 TGTGGGGTGGAGGAGGAGGGAGG - Intergenic