ID: 1089043899

View in Genome Browser
Species Human (GRCh38)
Location 11:115481917-115481939
Sequence GTGTCAATGAGGGGAGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089043899_1089043909 21 Left 1089043899 11:115481917-115481939 CCTCCCGCTCCCCTCATTGACAC 0: 1
1: 0
2: 0
3: 13
4: 232
Right 1089043909 11:115481961-115481983 ACTTCTCTTTATTACCAAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089043899 Original CRISPR GTGTCAATGAGGGGAGCGGG AGG (reversed) Intronic
900116389 1:1029459-1029481 GTGTCTATGAGGGCAGGTGGAGG + Intronic
901026268 1:6280240-6280262 CTGTCACTGAGGGGAGCAAGAGG - Intronic
901078828 1:6572136-6572158 GGGTCAATGAGGGCAGGGAGAGG - Intronic
902096121 1:13947420-13947442 GTGTCAAGGAAGGGACCAGGTGG - Intergenic
902374284 1:16022998-16023020 GTGCCAATGAGGGGACGTGGGGG + Intronic
902379238 1:16044875-16044897 GTGCCAATGAGGGGACGTGGGGG + Intronic
902483764 1:16727829-16727851 GTGGAGATGAGGGGAGCGGCGGG + Intergenic
903562806 1:24241286-24241308 GTGTCATTGGAGGGAGCCGGTGG - Intergenic
903577253 1:24346646-24346668 GAGTAAATGAGGAGGGCGGGAGG - Intronic
903791517 1:25896388-25896410 CTGCCAGTGAGGGGAGCAGGAGG + Intronic
904917866 1:33983327-33983349 GTGGCAAGGAGGGGAGAGGCAGG - Intronic
907259963 1:53210600-53210622 GTGGCAATGAGGAGAGCCTGAGG + Exonic
907303679 1:53502651-53502673 GAGACAGAGAGGGGAGCGGGAGG + Intergenic
907431453 1:54414453-54414475 GTGTCAAGGAAGGCAGCTGGAGG + Intergenic
909395797 1:75169477-75169499 GTGTGAATGAGGAGAGTGGGCGG + Intergenic
909957715 1:81800808-81800830 GTGTTAATGGGGGGAGCTGGAGG + Intronic
910001181 1:82344217-82344239 GTGACAATGAGAGAAGCGCGGGG + Intergenic
910916634 1:92296544-92296566 GTGTCAAGGATGGGACCAGGTGG - Intronic
911626832 1:100133381-100133403 CTGTCAAAGAGGGGAGGGGCCGG - Intronic
911945873 1:104108258-104108280 GTGTCAAGGAGGGGACCAGGTGG + Intergenic
912580555 1:110717416-110717438 GTTTCTCTGAGGGGAGAGGGAGG - Intergenic
915366584 1:155320329-155320351 ATGTGAATGAGGGGAGTGGAGGG + Intronic
916206510 1:162320518-162320540 TTGGCAATGTGGGGAGGGGGTGG - Intronic
916302658 1:163293487-163293509 GTGTCAAGGAAGGGACCTGGTGG - Intronic
916502896 1:165401665-165401687 CTGTGAATGAGGGGAGCTGAGGG - Intronic
918063409 1:181082092-181082114 GGGACAATAAGGGGAGAGGGAGG - Intergenic
918133254 1:181646993-181647015 GTGTCACTCAGGGGATCGGCAGG + Intronic
918332374 1:183472456-183472478 GGGTGAATGAGGCGAGGGGGAGG - Intronic
918747149 1:188218218-188218240 GTTTCAATAAGGGGAGGGGTAGG - Intergenic
920664710 1:207954493-207954515 GGGTCAGTGTGGGAAGCGGGAGG + Intergenic
920674292 1:208028696-208028718 GTGGCAGGGAGGGGAGTGGGAGG + Intronic
921680464 1:218025083-218025105 GTATCACTGTGGGGGGCGGGGGG - Intergenic
922321621 1:224493536-224493558 GTGGCAGAGAGGGGAGCAGGTGG + Intronic
922780400 1:228247917-228247939 GTGTCAATGGTGGGACCAGGTGG - Intronic
923094114 1:230761189-230761211 AGGCCAAGGAGGGGAGCGGGCGG - Intronic
923261844 1:232275210-232275232 GTGTCAAAGGGGGGACCTGGTGG + Intergenic
924511047 1:244729527-244729549 GAGGCAGTGAGGGGAGAGGGAGG + Intergenic
1062770320 10:94903-94925 GTGTCAAGGAAGGGACCTGGTGG - Intergenic
1063362017 10:5466881-5466903 CTGTCAAGGAGGGGAGGGGGAGG + Intergenic
1063717382 10:8541447-8541469 GTGTCAAAGGAGGGACCGGGTGG - Intergenic
1064512576 10:16111433-16111455 CTATGAATGAGGGGGGCGGGGGG + Intergenic
1066440853 10:35437135-35437157 GTGTCAATGGTGGGGCCGGGTGG - Intronic
1070094435 10:73323315-73323337 GTGTTAATGGCGGGGGCGGGGGG + Intronic
1070535151 10:77371642-77371664 GTTGCAATGAGGGGACCGGTGGG - Intronic
1070915577 10:80152431-80152453 GTGACCATGAGGGCAGCGAGAGG + Exonic
1071119486 10:82261261-82261283 GAGTGAATGAGTGAAGCGGGTGG - Intronic
1072491842 10:95914519-95914541 GTGTCAATGGGGGGACCAGATGG + Intronic
1074226303 10:111487844-111487866 GTGTCAAGGAGGGGACCTCGTGG + Intergenic
1076765455 10:132630698-132630720 GTGTCCATGAGGGTGGGGGGCGG + Intronic
1077492208 11:2866753-2866775 TTCTCAGTGAGGGGGGCGGGAGG + Intergenic
1078086955 11:8239628-8239650 GTGTGAATGAGGGGATGGGTAGG + Intronic
1079753441 11:24227575-24227597 GTGTCAATGGTGGGACCAGGTGG - Intergenic
1083823564 11:65185919-65185941 GTGGCAATTTGGGGAGTGGGTGG + Exonic
1084497824 11:69515308-69515330 GTCACCATGTGGGGAGCGGGAGG - Intergenic
1087501376 11:98958828-98958850 GTGTCAATGGAGGGACCAGGTGG - Intergenic
1089043899 11:115481917-115481939 GTGTCAATGAGGGGAGCGGGAGG - Intronic
1089619216 11:119713015-119713037 GAGTCAATGGGTGGGGCGGGTGG + Intronic
1090274888 11:125412182-125412204 GGGTCACTGCGGGGAGTGGGTGG + Intronic
1090298548 11:125612801-125612823 GTGTGTATGTGGGCAGCGGGGGG + Intronic
1091818319 12:3455862-3455884 GTGTCACTGAGGGGTGTGGTAGG - Intronic
1092805828 12:12221421-12221443 GTGTCAGAGAGGGAAGAGGGGGG - Intronic
1092833010 12:12463480-12463502 GTGTAAAAGAGGGGAGCTGCTGG + Intronic
1096647603 12:53047235-53047257 GTGGCAGTGGCGGGAGCGGGCGG - Intronic
1097288714 12:57896675-57896697 CTGCCCATGAGGGGCGCGGGTGG - Intergenic
1097613748 12:61859331-61859353 GTGTCAATGGTGGGAGCAGATGG - Intronic
1097984595 12:65770083-65770105 ATGTCATTGAGAGGAGCGAGGGG + Intergenic
1101663074 12:106784263-106784285 GTATAAATCAGGGGAGTGGGAGG + Intronic
1101694002 12:107107441-107107463 GTGGCACTGAGGGCAGTGGGTGG - Intergenic
1103191944 12:119008951-119008973 GTGGCAATGAGAGGAGGGAGGGG - Intronic
1105608078 13:21943841-21943863 ATGTCAATGATGGGACCAGGTGG - Intergenic
1105849908 13:24323964-24323986 GTGTCAAGGCAGGGACCGGGTGG - Intergenic
1106512227 13:30421870-30421892 GTGGTAAGGAGAGGAGCGGGGGG + Intergenic
1111318862 13:86597213-86597235 GTGTCAAGGAAGGGACCTGGTGG + Intergenic
1115351988 14:32405630-32405652 GTGTCAATGGTGGGACCAGGTGG + Intronic
1118113932 14:62752672-62752694 GTGTCAATGGAGGGACCTGGTGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119745494 14:77040812-77040834 GTGTGAAAGAGGAGAGCGGGAGG - Intergenic
1120930677 14:89844951-89844973 GAGGCAGTGAGGGGAGGGGGCGG + Intronic
1121566291 14:94912476-94912498 TTGGCAAGGAGGGGAGCTGGGGG - Intergenic
1122291017 14:100680538-100680560 GTGACAATGGGGGGAGGCGGAGG - Intergenic
1122359379 14:101150562-101150584 GTCTCCCTGAGGGGAGTGGGTGG + Intergenic
1122634690 14:103124447-103124469 GTGTCACAGAGGGGAGAAGGCGG + Intronic
1123450274 15:20355596-20355618 GTGTCAGGGAGGGGAGGGGCTGG + Intergenic
1124555953 15:30726315-30726337 GTGTCAAGGATGGGACCAGGTGG - Intronic
1124827288 15:33110615-33110637 GCGTCAATGTGAGGGGCGGGGGG - Intronic
1125460897 15:39905795-39905817 GGGTGAAGGAGGGGATCGGGTGG + Intronic
1125854055 15:42932250-42932272 GTGTCAAGGGCGGGAGCAGGTGG + Intergenic
1126362875 15:47864268-47864290 GTGTCAAGGGAGGGAGCTGGTGG + Intergenic
1128845419 15:70890718-70890740 TTGGCAATGATGGGAGTGGGAGG + Intronic
1132236963 15:100229279-100229301 CTGTCAATGTGGGGAGGGGGTGG - Intronic
1133978963 16:10619525-10619547 GTGGCAGTGGGGGGAGCAGGTGG + Intergenic
1135574186 16:23572580-23572602 GGGGCAATAAGGGGAGCAGGTGG - Exonic
1137790391 16:51170128-51170150 GTGCCATTGAGGGGAGCAGGTGG + Intergenic
1138130677 16:54477128-54477150 GTGTCAAGGAGGGGACCTGAGGG - Intergenic
1138821145 16:60261644-60261666 GTGTCAAGGATGGGACCAGGTGG - Intergenic
1139283823 16:65792903-65792925 GTGTCAAGGAAGGGACCTGGTGG - Intergenic
1141904986 16:87018693-87018715 GTGGCAAGGAGAGGAGCGTGGGG - Intergenic
1142378027 16:89716961-89716983 GGGTCAGTGAGGGGATGGGGGGG - Intronic
1143448090 17:7020353-7020375 GTGGCAAGGAGGGGTGCTGGTGG - Intergenic
1144289274 17:13809815-13809837 GTGTCAAGGAGGGTACCTGGTGG + Intergenic
1144648140 17:16989287-16989309 GTCTCAATGATGGGGGTGGGAGG + Intergenic
1147839828 17:43363483-43363505 GTGCCAATGAGGGGAGCACCCGG - Intergenic
1147914863 17:43880139-43880161 GTGCCAATGGGGAGAGTGGGGGG - Intronic
1149432186 17:56603184-56603206 GTGACATTTAGGGGAGCTGGTGG - Intergenic
1151104813 17:71600565-71600587 GTGTCAGTGAGGAGGACGGGTGG - Intergenic
1151631756 17:75315770-75315792 GTGTCAGGGAGGGGTGGGGGGGG + Intergenic
1152338210 17:79709839-79709861 GTGTCAGGGAGGGGAGGGGCTGG - Intergenic
1152338268 17:79710014-79710036 GTGTCAGGGAGGGGAGGGGCTGG - Intergenic
1152338352 17:79710276-79710298 GTGTCAGGGAGGGGAGGGGCTGG - Intergenic
1154123445 18:11669993-11670015 GTGTAAATGAGGAGGGCCGGAGG - Intergenic
1154197001 18:12274068-12274090 GTGACAATGGGGGGAGGGGCAGG - Intronic
1155457074 18:26029182-26029204 GAGTGAATGAGGGCAGCGAGTGG + Intronic
1159651845 18:70987095-70987117 GTGTCAAGGGAGGGAGCTGGTGG + Intergenic
1161510724 19:4669822-4669844 GGGTCAGTGATGGGAGCGGCAGG - Intronic
1161968348 19:7561372-7561394 GTGTCAGGCAGGGGAGCCGGGGG + Intronic
1162456536 19:10788387-10788409 GAGTGAGTGAGGGGAGTGGGAGG + Intronic
1162897619 19:13774798-13774820 GGATCAGTGAGGGGAGAGGGTGG + Intronic
1163651743 19:18521845-18521867 GCCTCAGTGAGGGGAGCGCGAGG + Intronic
1165061486 19:33207210-33207232 GTGTCCATGAGCGGTGCTGGGGG - Exonic
1166023440 19:40055243-40055265 ATGGCAAGGTGGGGAGCGGGCGG + Intronic
1166881655 19:45933909-45933931 ATGGCAATGTGGGGAGTGGGAGG + Exonic
1167293198 19:48635626-48635648 GTGCCCAGGAGAGGAGCGGGGGG + Exonic
1168317795 19:55491607-55491629 GCGTGAATGAGGGGAGATGGAGG - Intronic
1168339184 19:55614015-55614037 GCGTCAAAGAGGGGAGGAGGGGG - Exonic
925056363 2:860554-860576 GTGCCATGGAGGGGAGAGGGTGG - Intergenic
926172920 2:10564571-10564593 GAGGCAGTGAGGGGAGCAGGTGG - Intergenic
926469207 2:13232199-13232221 GTGTCCATGCGTGGAGCAGGAGG + Intergenic
927960182 2:27236392-27236414 CTGTCAATGCGTGGAGCTGGGGG + Exonic
931748047 2:65307944-65307966 GTGTGAATGGGGGGGGCGGGGGG - Intergenic
935900819 2:107790765-107790787 GTGTCAAGGAAGGGACCTGGTGG - Intergenic
936822853 2:116543755-116543777 GTGTCAAGGATGGGACCTGGTGG - Intergenic
937294410 2:120801020-120801042 GTGACAGTGAGGGGTGGGGGAGG - Intronic
937742081 2:125367055-125367077 GTGTCATGGAAGGGAGCTGGTGG + Intergenic
938307713 2:130266354-130266376 GTGTCACTGAGGGGGGCTTGGGG - Intergenic
938447625 2:131390487-131390509 GTGTCACTGAGGGGGGCTTGGGG + Intergenic
938924337 2:136025314-136025336 TTGAGAGTGAGGGGAGCGGGTGG + Intergenic
942226358 2:173820029-173820051 GTGTGAAGGAGGGGAGCCAGGGG + Intergenic
944743845 2:202635981-202636003 GGGTGAATGAGGCGGGCGGGCGG - Intronic
945005757 2:205403977-205403999 GTGTGCATGAGGGGTGCTGGGGG - Intronic
946308713 2:218871246-218871268 GGGTCAGTGTGGGGAGGGGGCGG + Exonic
947495017 2:230628761-230628783 GTGTCAAGGGTGGGAGCAGGTGG + Intergenic
947791148 2:232870166-232870188 GTGTTGGTGGGGGGAGCGGGGGG + Intronic
948042801 2:234917028-234917050 CTGGCAATGAGGGGACCAGGTGG - Intergenic
1172893331 20:38282644-38282666 GTGTCAAAGGGGGGACCAGGTGG - Intronic
1173225763 20:41161713-41161735 GTGTCAAGGAGGGGAGGGGAGGG - Intronic
1174021545 20:47534100-47534122 GTTTCAGTGGGGGGGGCGGGGGG + Intronic
1175133947 20:56809070-56809092 GTGTGTATGTGGGGTGCGGGGGG - Intergenic
1175457480 20:59126401-59126423 GTGTCACTGTGGGGAGCTTGTGG + Intergenic
1177270955 21:18849139-18849161 GTGTCAATGGTGGGATCAGGTGG + Intergenic
1178336355 21:31747009-31747031 GTGTGAATCAGGAGAGAGGGTGG + Intergenic
1181990352 22:26832351-26832373 GCCTGAATGAGGGGAGAGGGAGG - Intergenic
1183349491 22:37326929-37326951 GGGTCACTGACGGGAGAGGGTGG - Intergenic
1183616523 22:38949013-38949035 GTGACAATGACGGGAGAGGAGGG - Intergenic
1183619130 22:38962396-38962418 GTGACAATGACGGGAGAGGAGGG - Intronic
1183624330 22:38992332-38992354 GTGACAATGACGGGAGAGGAGGG - Intronic
1183935450 22:41259282-41259304 AGGGCAATGGGGGGAGCGGGTGG + Intronic
1184073398 22:42161118-42161140 GTGACAATGTGGGGGGAGGGGGG - Exonic
1184613372 22:45620964-45620986 GTGTCAAGGAAGGGACCTGGTGG - Intergenic
951246261 3:20345089-20345111 GTGTCAAGGGAGGGAGCTGGTGG - Intergenic
951259106 3:20485370-20485392 GTGTGTATGTGGGGAGAGGGGGG + Intergenic
952396456 3:32924987-32925009 CTGTCAGGGTGGGGAGCGGGAGG - Intergenic
952414321 3:33076525-33076547 GTGACAATGAGGTGGGCAGGAGG + Intronic
954430941 3:50470579-50470601 GTGTATATGGGGGGAGGGGGCGG + Intronic
956493532 3:69799799-69799821 GTGTCACTGAAGAGAGCAGGGGG + Intronic
957313495 3:78548373-78548395 GTGTCAAGGATGGGATCAGGTGG - Intergenic
959771915 3:110108796-110108818 GTGTCAAGGGCGGGAGCAGGTGG - Intergenic
960400618 3:117193238-117193260 GTGTCAATGGTGGGACCAGGTGG - Intergenic
963783165 3:149507518-149507540 GTGTCAGTGAGGGGAGGCAGTGG + Intergenic
965183359 3:165433452-165433474 GTGTCAATGGAGGGACCTGGTGG + Intergenic
965372382 3:167879677-167879699 GTGTGCATGAGGGGAGAGAGGGG - Intergenic
969563976 4:7966865-7966887 GTGTCCATGGGGTGGGCGGGAGG - Exonic
970905313 4:21209007-21209029 GTGTCAAGGATGGGACCAGGTGG - Intronic
970987081 4:22171312-22171334 GTGTCAAGGGCGGGACCGGGTGG - Intergenic
971939617 4:33198509-33198531 ATGGCAATGAGGGGAGAGGCAGG + Intergenic
974317819 4:60305691-60305713 GTGTCAAGGACGGGACCAGGTGG - Intergenic
975064765 4:70047284-70047306 GTGACAATGAGTGGGGTGGGTGG - Intergenic
978463592 4:108984474-108984496 GAGACCATGAGGGGGGCGGGAGG + Intronic
978896164 4:113890055-113890077 GTGTCACGGAAGGGATCGGGTGG - Intergenic
979781287 4:124653984-124654006 GTGTCAAGGGAGGGAGCTGGTGG + Intergenic
983890280 4:173023169-173023191 GAGTCAGTGTGGGGAGAGGGAGG + Intronic
986337548 5:6766693-6766715 GTGCCAGCGAGGGGAGAGGGAGG - Intergenic
988338917 5:29943330-29943352 GTGTCAAGGATGGGACCAGGTGG - Intergenic
989373196 5:40731665-40731687 GTGTCAAGGATGGGACCAGGTGG - Intronic
991501604 5:67282736-67282758 GGATAAATGAGGGGAGTGGGTGG - Intergenic
993257769 5:85615995-85616017 GTGTCAAAGATGGGAGCAGGTGG - Intergenic
994047917 5:95330105-95330127 GTGTCAAGGAAGGGACCTGGTGG + Intergenic
995846380 5:116498560-116498582 GTGTGCATGGGGGGAGGGGGTGG + Intronic
997817563 5:137033589-137033611 GTGTGAATGAGGTGAGGGAGAGG - Intronic
1000633594 5:163618163-163618185 GTGACAATAAGGGCAGCAGGTGG + Intergenic
1001163435 5:169341772-169341794 GTGTCTGTGAGGGGAACAGGGGG + Intergenic
1001435354 5:171695458-171695480 CTGTCAATGAGGGCAGGGGTGGG - Intergenic
1002093012 5:176815806-176815828 GTGTCAATGGCGGGGGAGGGGGG - Intronic
1003153138 6:3569920-3569942 GTGCCAGGGAGGGGAGAGGGAGG - Intergenic
1003757256 6:9135675-9135697 GTGTCAAGGAAGGGACCTGGTGG - Intergenic
1004604795 6:17183913-17183935 GTGTAAATGAAGGAAGCGGCAGG - Intergenic
1006796774 6:36737160-36737182 GGGTCAGGGAGTGGAGCGGGTGG - Intergenic
1006882906 6:37354711-37354733 GTGTCGAGGAGGGGAGGGCGGGG + Intronic
1007099492 6:39235652-39235674 GTGGCCATGGTGGGAGCGGGAGG + Intergenic
1007765176 6:44155642-44155664 GTGTCACTGAGAGGAGAGAGTGG + Intergenic
1010030248 6:71266044-71266066 GCGTCCAGGAGGGGGGCGGGGGG - Intergenic
1010913313 6:81585957-81585979 ATGTCAATGATGGGACCAGGTGG - Intronic
1018839915 6:167509220-167509242 GTGTGAAGGAGGTGAGGGGGAGG - Intergenic
1019162130 6:170075850-170075872 GTGGCAATGAGGGCACCTGGAGG - Intergenic
1020475793 7:8592947-8592969 GGGACAATGAGGAGAGCAGGTGG - Intronic
1020493075 7:8813274-8813296 ATGTCAAAGAGGGGAGAGAGGGG + Intergenic
1024313487 7:47991767-47991789 GTGTCCATGTGGGGAGCGTGTGG + Intronic
1028256480 7:88604447-88604469 GTGTCAAGGAAGGGACCTGGTGG + Intergenic
1028723553 7:94060980-94061002 GTGTTAGTGAGAGGAGTGGGAGG - Intergenic
1029328634 7:99832327-99832349 GTGTCAAGGAAGGGACCTGGTGG + Intronic
1031489708 7:122371529-122371551 GTGTCAAGGGTGGGAGCAGGTGG - Intronic
1033738123 7:144244945-144244967 GTCTCAATGGGGGGGGTGGGGGG - Intergenic
1033744930 7:144306008-144306030 GTCTCAATGGGGGGGGTGGGGGG + Intergenic
1034511100 7:151535430-151535452 GTGTCGAAGAGGGGACCTGGTGG + Intergenic
1035556508 8:570961-570983 CTGGCCGTGAGGGGAGCGGGTGG + Intergenic
1036608350 8:10328248-10328270 GTGTCAATGAGTGGGGAGGGGGG - Intronic
1037403228 8:18515024-18515046 GTGTCAATGAGTGGTGCCTGTGG + Intergenic
1037750759 8:21680756-21680778 GGGGCAAAGAGGGGAGCAGGTGG - Intergenic
1041045031 8:53880549-53880571 TCGTGAATGAAGGGAGCGGGAGG - Intronic
1041522397 8:58770895-58770917 ATTTCCATGAGTGGAGCGGGTGG + Intergenic
1042116829 8:65441464-65441486 GTGTCAAGGATGGGACCAGGTGG + Intergenic
1042225900 8:66514121-66514143 GTGTCACTGAGGGGTGTCGGGGG - Intronic
1043967434 8:86494935-86494957 GTGTCACTGAGGGTAGAGTGTGG - Intronic
1044328614 8:90890187-90890209 GTGTCAAGGATGGGACCAGGTGG + Intronic
1049349171 8:142154884-142154906 GTGTCTATGAGGCCAGCGTGAGG - Intergenic
1050218550 9:3358963-3358985 GTGTCAAGGGTGGGACCGGGTGG - Intronic
1050715045 9:8514820-8514842 GTGTCAAAGAAGGGACCTGGTGG + Intronic
1051143878 9:14006759-14006781 GTGTTAATGAGGTGACAGGGGGG + Intergenic
1056627282 9:88264162-88264184 TTGTCAAAGAGGGGAGGGGAGGG + Intergenic
1057008848 9:91583973-91583995 CTGTCAGGGAGGGGAGTGGGTGG - Intronic
1057195861 9:93115451-93115473 GGGTGAATGAGGGGTGAGGGAGG + Intergenic
1057568968 9:96189247-96189269 GGGTCAATAAGGAGAGCTGGGGG + Intergenic
1058337698 9:103853348-103853370 GTGTCAAGGAGGAGACCAGGTGG - Intergenic
1058852604 9:109027307-109027329 CTGCCAAGGAGGGGAGAGGGTGG - Intronic
1059234081 9:112747631-112747653 GTGTGCATGAGGGGCGAGGGAGG - Intergenic
1059743020 9:117171553-117171575 GTGTCAATGGAGGGACCTGGTGG + Intronic
1061686030 9:132279263-132279285 GTTTCAAAAAGGGGAGGGGGAGG + Intronic
1189288031 X:39866018-39866040 GTGTCAAGGTGGAGAGTGGGAGG + Intergenic
1192132883 X:68569327-68569349 GTGTCAAGGAAGGGACCTGGTGG - Intergenic
1192180759 X:68914353-68914375 GTGTGGGGGAGGGGAGCGGGAGG - Intergenic
1192416663 X:70987191-70987213 GTGTCAATGGTGGGAGCAGGTGG - Intergenic
1192464906 X:71347884-71347906 GTGGCGATGGGGGGAGGGGGAGG - Intergenic
1194786118 X:98086269-98086291 GAGTCAAGGCGGGGAGCTGGTGG - Intergenic
1196864885 X:120061763-120061785 GTGTCAAGGATGGGACCAGGTGG + Intergenic
1196878216 X:120174569-120174591 GTGTCAAGGATGGGACCAGGTGG - Intergenic
1199533031 X:148871060-148871082 GTGTGGTTGTGGGGAGCGGGTGG + Intronic
1200046913 X:153408114-153408136 GAGTCAGTGAAGGGAGAGGGAGG + Intergenic