ID: 1089044957

View in Genome Browser
Species Human (GRCh38)
Location 11:115492767-115492789
Sequence CAATTCCAGTCTAACATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089044957 Original CRISPR CAATTCCAGTCTAACATCTG AGG (reversed) Intronic
901164824 1:7211910-7211932 CAATTCTAGTCCAACATCACAGG + Intronic
901279539 1:8023155-8023177 CTAGTCCAGTTTCACATCTGGGG + Intronic
902455452 1:16530683-16530705 CACTTTCAGGGTAACATCTGGGG + Intergenic
904068984 1:27778157-27778179 CAATTCCAACCCCACATCTGTGG - Intronic
904632223 1:31850960-31850982 CAATTCCAATCTAATATTTCGGG + Intergenic
910038336 1:82816435-82816457 CAATTTCAGTCTAACACCACAGG - Intergenic
912342662 1:108932601-108932623 CAGTTACAGTCTATCACCTGGGG + Exonic
917159350 1:172040281-172040303 CAATTACAGTCTAGCTTCTTTGG + Intronic
921124570 1:212166057-212166079 CAATTCCAATCCAACATCACAGG + Intergenic
921745095 1:218731446-218731468 CACATCCACTGTAACATCTGAGG + Intergenic
924631162 1:245742313-245742335 CAATTAAAATCCAACATCTGGGG - Intergenic
1065043633 10:21724605-21724627 CAATTCTACTTTAACATTTGTGG + Intronic
1066152083 10:32633325-32633347 CAATTCCAGTTTATCCTCTCAGG + Intronic
1073158575 10:101369764-101369786 CAATTCCAGTCTAATACCACAGG + Intronic
1074221230 10:111440276-111440298 CAATTCCAGACTCACCTTTGTGG + Intergenic
1078107068 11:8365219-8365241 CAATTCCAGCCCCACAGCTGGGG - Intergenic
1081916307 11:46733085-46733107 CAATTCCATTCTAACACCACAGG + Intronic
1086409997 11:86535496-86535518 CAAATCCAGCCTATCAGCTGGGG - Intronic
1087625314 11:100589026-100589048 CAATTTCAGTCTAACACCCTAGG - Intergenic
1088559302 11:111096603-111096625 CATTTCCAGTCTATTATTTGAGG - Intergenic
1088653959 11:111981447-111981469 CAATTCCAGTTTTTCTTCTGAGG - Intronic
1089044957 11:115492767-115492789 CAATTCCAGTCTAACATCTGAGG - Intronic
1089088849 11:115849072-115849094 CAACTCTTGTCAAACATCTGTGG + Intergenic
1089183856 11:116601627-116601649 CACTTCAAGTCTAACAGCAGAGG - Intergenic
1090567163 11:128007041-128007063 CAATTCCAGCCTGCCAGCTGTGG + Intergenic
1091009904 11:131991106-131991128 CAATGCCATTCTAACTACTGAGG + Intronic
1092934214 12:13345402-13345424 CAATTTCAGTGGAACATCTCTGG - Intergenic
1094278108 12:28702060-28702082 CAATGCCAGTCTGACTTCTGTGG + Intergenic
1099883574 12:88499590-88499612 AAGTTCCAGTCTAACATATTTGG + Intronic
1102378757 12:112445514-112445536 CAATTACAATCTAACATCATGGG + Intronic
1107077989 13:36344524-36344546 CAATTTCAGTCTAATCTCTGGGG + Intronic
1113343279 13:109447563-109447585 CAATCCCAGTTATACATCTGGGG + Intergenic
1114364684 14:22013631-22013653 CTATTCCAGTATAAGATTTGTGG + Intergenic
1115910195 14:38247598-38247620 TAATTCCAGTCTAACACCATAGG - Intergenic
1124028326 15:25987296-25987318 GAATTCCAGTGAAACAGCTGAGG - Intergenic
1125605130 15:40935878-40935900 CTACTCCAGTCTAACAAATGGGG + Intronic
1127246734 15:57184787-57184809 AAATTTCAGTATAACATCTATGG + Intronic
1128586307 15:68853219-68853241 CAGTTCCAGTCCAGCATCTCAGG - Intronic
1131454607 15:92573355-92573377 CAACTCCAGTCTAACTTCGGAGG - Intergenic
1132930723 16:2457922-2457944 CAAGTCCTCTGTAACATCTGAGG + Exonic
1133614460 16:7463161-7463183 CAAGTCCCTTCTACCATCTGAGG - Intronic
1134043869 16:11087359-11087381 AAAGTCCAGCCTAACACCTGGGG - Intronic
1134090045 16:11386711-11386733 CAAGTCAAGTCTAACCTCTGTGG - Intronic
1134463435 16:14450432-14450454 CAATTTCAGTCTATCCTCAGAGG - Intronic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1138720161 16:59070659-59070681 CAGATCCAGTTGAACATCTGGGG + Intergenic
1141359692 16:83384129-83384151 CAATTCCAATCTAATATCTAAGG + Intronic
1142918698 17:3165065-3165087 CAATTCCAGTGCAACATCTCAGG - Intergenic
1143627660 17:8120491-8120513 CATTTCCAGTCTAAAAGATGTGG - Intergenic
1145302348 17:21649527-21649549 CAGTTCCAGTTTACCATATGAGG + Intergenic
1145347970 17:22053785-22053807 CAGTTCCAGTTTACCATATGAGG - Intergenic
1145415614 17:22711597-22711619 CAGTTCCAGTTTACCATATGTGG + Intergenic
1148801363 17:50228610-50228632 CAATTCCAGTCCAACACCACAGG + Intergenic
1148957523 17:51365973-51365995 CAAATCCAGTAAAACATGTGGGG - Intergenic
1149250801 17:54766907-54766929 ACATTCCAGTCTATCATCAGTGG + Intergenic
1158123548 18:54077396-54077418 CAATTCCAATGCAACATCAGAGG - Intergenic
1158514253 18:58118104-58118126 CAATGCCAGCCGAACTTCTGAGG - Intronic
1165822769 19:38686931-38686953 CCATTCCAGTCTAACAAATCTGG + Intronic
928497937 2:31853694-31853716 CAATTCCAAACTAAAACCTGAGG + Intergenic
931472888 2:62557133-62557155 AAATTCCTGTTTAACATCTGGGG - Intergenic
935135189 2:100293894-100293916 CAAATCTAGTCCAACTTCTGAGG - Intronic
935786075 2:106550034-106550056 CAAGTCCCTTCTACCATCTGAGG + Intergenic
936453437 2:112651297-112651319 CAATTCCAGTGGAAAATCTTGGG - Intronic
937147340 2:119659043-119659065 CAATTCCAGTCCAACACCTGGGG + Intronic
937161656 2:119768537-119768559 CAATTCCAATCTAACATCTCAGG + Intronic
937381045 2:121376627-121376649 CAATACCAGTCTATGGTCTGGGG - Intronic
938052832 2:128190785-128190807 CATTTCTGGTCTTACATCTGAGG - Exonic
938784424 2:134612071-134612093 CAAGTCCAGTCTGTCACCTGTGG - Intronic
940384411 2:153053518-153053540 CAATTCCAGCATAAAATTTGGGG - Intergenic
941425203 2:165335546-165335568 CAATTCCATTCTTTCATATGTGG - Intronic
943404711 2:187465793-187465815 CAATTCCAGTGTCAGATTTGAGG + Exonic
943841677 2:192591240-192591262 CAAGTCCAGTCTAACATGGATGG - Intergenic
945004813 2:205393433-205393455 CTATTAAAGTCTGACATCTGTGG - Intronic
945284214 2:208065912-208065934 CTATTCCAGTCTTGCAGCTGAGG + Intergenic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
1169890023 20:10442639-10442661 CAATTCAAGTCTAAATTCAGTGG - Intronic
1171518929 20:25760954-25760976 CAGTTCCAGTTTACCATATGAGG + Intergenic
1171558740 20:26101325-26101347 CAATTCAAGTCTTCCATCTAGGG - Intergenic
1174333438 20:49839928-49839950 CAATTCCATTTTGACAACTGAGG + Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1174935560 20:54864394-54864416 CAATTGCAATGTAACAACTGAGG - Intergenic
1175034343 20:55985484-55985506 CAATTCCAGTCAAACAACACAGG - Intergenic
1176653077 21:9567362-9567384 CAGTTCCAGTTTACCATATGAGG + Intergenic
1178193525 21:30315277-30315299 AAATTCCACTCCAAAATCTGGGG - Intergenic
1178384731 21:32139867-32139889 CAAGTCCTGTCTTACATATGTGG - Intergenic
1178501697 21:33130989-33131011 CAATTCCAGTCCAACACCAAAGG + Intergenic
1178638296 21:34324520-34324542 CAATTACATTTTAACATCTTGGG + Intergenic
1179168126 21:38951293-38951315 GAATCTCACTCTAACATCTGTGG - Intergenic
1183859819 22:40661765-40661787 CAATCCCAGTTTAAAAGCTGAGG - Intergenic
1184292624 22:43506177-43506199 CAATGCCAGGCAAACAGCTGTGG - Exonic
949560038 3:5192853-5192875 CAAATCCTCTCTAAGATCTGGGG - Intronic
952032222 3:29157154-29157176 CAATTACATCCTAACATCTGAGG + Intergenic
953379967 3:42462461-42462483 CAAGTCCAGTTCCACATCTGAGG + Intergenic
959603744 3:108220206-108220228 CATCACCAGTCAAACATCTGTGG + Intronic
960031917 3:113062692-113062714 CAATTTCAATCCAACATCTGAGG + Intergenic
960464082 3:117974069-117974091 CATCCCCAGTCTAAAATCTGTGG - Intergenic
965475505 3:169150137-169150159 CAAGGCCAGTCTAACTACTGTGG - Intronic
967075906 3:186001736-186001758 GAATTCAAGTCAAACTTCTGTGG - Intergenic
971097232 4:23421219-23421241 CAATTCCAGCCTTAGATCTTAGG - Intergenic
974097000 4:57374643-57374665 CAGTTTCAATCTTACATCTGTGG - Intergenic
975743135 4:77450069-77450091 CAATTTCAGTCCCACATCTCAGG + Intergenic
979763318 4:124434404-124434426 CAGTTCCCGTCTATCATTTGAGG - Intergenic
980632908 4:135460369-135460391 CATTTCCAGTCTATCCTCAGTGG - Intergenic
981094939 4:140769472-140769494 CAGTTCCTTTCTAAAATCTGTGG + Intergenic
982843978 4:160226197-160226219 CAATTCCAGTCAGATATCTGGGG - Intergenic
983064890 4:163197066-163197088 CAATTCCAAAGTAACTTCTGAGG - Intergenic
983299425 4:165906370-165906392 CAATACCAATTTAACATGTGAGG + Intronic
983793973 4:171836901-171836923 CAATTCCATTCTAATACCTTAGG - Intronic
984667600 4:182445844-182445866 CAATTCTTGTCTAAGATCTGCGG - Intronic
987049630 5:14138637-14138659 CAATTCCAACCCAACATCTTCGG + Intergenic
990472578 5:56129922-56129944 CCATTCTAGTCTAACATGTCTGG - Intronic
997396225 5:133562096-133562118 CAATTCAAGACTGCCATCTGGGG - Intronic
999345006 5:150810062-150810084 CAATTCCAATCTAACAGCACAGG + Intergenic
1005938824 6:30545908-30545930 CTGTTCCAGGCTAACAGCTGTGG - Exonic
1014573116 6:123036066-123036088 CAATTCCATTGTAAAATTTGAGG + Intronic
1015809150 6:137143733-137143755 AAATTCCAGTTAAACATCTTAGG - Intergenic
1021396725 7:20158536-20158558 CAAGTCCAATCTTACCTCTGAGG + Exonic
1021690456 7:23225724-23225746 CAATTCCAATCTAATATCGCAGG - Intergenic
1022190043 7:28008470-28008492 CAATTCCAGTATAAATTCTAAGG + Intronic
1027579865 7:79978843-79978865 CAATTCCTGTATAAGACCTGAGG - Intergenic
1027596924 7:80185405-80185427 GAATTCCAATTTAACAGCTGAGG + Intronic
1035123584 7:156590697-156590719 CAGTTCCAGTCTAAATTTTGAGG - Intergenic
1036466394 8:9002007-9002029 CAATGGCAGTTTCACATCTGAGG + Intergenic
1037379272 8:18266938-18266960 CACTCCCAGTCTCACATATGTGG - Intergenic
1039228249 8:35413989-35414011 CCATTCCAGTCAAGAATCTGAGG - Intronic
1040436123 8:47393435-47393457 CAATTCCACATTACCATCTGAGG + Intronic
1041106338 8:54447520-54447542 CAATTCCAATCCAACATCTTAGG - Intergenic
1042089985 8:65148313-65148335 CAATACCAGTCTCCCAACTGAGG + Intergenic
1046802357 8:118442444-118442466 CATTTTCCCTCTAACATCTGTGG + Intronic
1049524106 8:143112246-143112268 CAATTCCACTCTTCCATTTGTGG + Intergenic
1049544612 8:143224204-143224226 CAATTCCACTCTTCCATTTGTGG - Intergenic
1052500408 9:29281865-29281887 AAATTCCATTCTAACACATGGGG + Intergenic
1052686034 9:31757195-31757217 CCATTCCAGCCTAACATCTCAGG + Intergenic
1057176615 9:93004823-93004845 CCATTCCAGTCAAGCCTCTGTGG - Intronic
1058955654 9:109944988-109945010 TACATCCAGTCTAACTTCTGTGG + Intronic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1061964360 9:134004694-134004716 CACCTCCAGGCTCACATCTGAGG - Intergenic
1186280567 X:7988695-7988717 GAATTCCAGTGAAACAGCTGAGG + Intergenic
1186352873 X:8757672-8757694 GAATTCCAGTGAAACAGCTGAGG - Intergenic
1188762319 X:34048039-34048061 AAATTCCAGTGTAACTTGTGTGG + Intergenic
1198417239 X:136433137-136433159 CAAATCCACACTAACATCTTTGG + Intergenic
1200008308 X:153102614-153102636 CAATTTGAGTCAAACAACTGTGG - Intergenic
1200730050 Y:6724958-6724980 TGATGCCAGTCTAACATTTGAGG + Intergenic