ID: 1089048689

View in Genome Browser
Species Human (GRCh38)
Location 11:115526892-115526914
Sequence ATATGTTAACTGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089048689_1089048696 6 Left 1089048689 11:115526892-115526914 CCAGCCTCCCTCAGTTAACATAT No data
Right 1089048696 11:115526921-115526943 GGATGAAACAGCACCTGGAAAGG No data
1089048689_1089048695 1 Left 1089048689 11:115526892-115526914 CCAGCCTCCCTCAGTTAACATAT No data
Right 1089048695 11:115526916-115526938 GTATAGGATGAAACAGCACCTGG No data
1089048689_1089048698 8 Left 1089048689 11:115526892-115526914 CCAGCCTCCCTCAGTTAACATAT No data
Right 1089048698 11:115526923-115526945 ATGAAACAGCACCTGGAAAGGGG No data
1089048689_1089048697 7 Left 1089048689 11:115526892-115526914 CCAGCCTCCCTCAGTTAACATAT No data
Right 1089048697 11:115526922-115526944 GATGAAACAGCACCTGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089048689 Original CRISPR ATATGTTAACTGAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr