ID: 1089054849

View in Genome Browser
Species Human (GRCh38)
Location 11:115577241-115577263
Sequence CAGGATTGCTTATTAGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089054845_1089054849 10 Left 1089054845 11:115577208-115577230 CCAAATACAATAAGCAAAGTGTG No data
Right 1089054849 11:115577241-115577263 CAGGATTGCTTATTAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089054849 Original CRISPR CAGGATTGCTTATTAGCCAA GGG Intergenic
No off target data available for this crispr