ID: 1089058417

View in Genome Browser
Species Human (GRCh38)
Location 11:115606672-115606694
Sequence CCTGCGCAGAAGGTTCGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089058409_1089058417 18 Left 1089058409 11:115606631-115606653 CCTCTGCTGCAGCTGTTGGCAAA No data
Right 1089058417 11:115606672-115606694 CCTGCGCAGAAGGTTCGGGCCGG No data
1089058407_1089058417 26 Left 1089058407 11:115606623-115606645 CCAGTTCACCTCTGCTGCAGCTG No data
Right 1089058417 11:115606672-115606694 CCTGCGCAGAAGGTTCGGGCCGG No data
1089058406_1089058417 27 Left 1089058406 11:115606622-115606644 CCCAGTTCACCTCTGCTGCAGCT No data
Right 1089058417 11:115606672-115606694 CCTGCGCAGAAGGTTCGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089058417 Original CRISPR CCTGCGCAGAAGGTTCGGGC CGG Intergenic
No off target data available for this crispr