ID: 1089066969

View in Genome Browser
Species Human (GRCh38)
Location 11:115669618-115669640
Sequence CTGTAATAGTCTAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089066965_1089066969 0 Left 1089066965 11:115669595-115669617 CCTGGGTGTTAGTTAGGAGCCTA No data
Right 1089066969 11:115669618-115669640 CTGTAATAGTCTAGGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089066969 Original CRISPR CTGTAATAGTCTAGGAAAGA GGG Intergenic
No off target data available for this crispr