ID: 1089067224

View in Genome Browser
Species Human (GRCh38)
Location 11:115670954-115670976
Sequence AAGGACCCTGTGAAGTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089067224_1089067231 25 Left 1089067224 11:115670954-115670976 CCTGCAGACTTCACAGGGTCCTT No data
Right 1089067231 11:115671002-115671024 CCTCATCTATCATATGCACTTGG No data
1089067224_1089067233 29 Left 1089067224 11:115670954-115670976 CCTGCAGACTTCACAGGGTCCTT No data
Right 1089067233 11:115671006-115671028 ATCTATCATATGCACTTGGTGGG No data
1089067224_1089067232 28 Left 1089067224 11:115670954-115670976 CCTGCAGACTTCACAGGGTCCTT No data
Right 1089067232 11:115671005-115671027 CATCTATCATATGCACTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089067224 Original CRISPR AAGGACCCTGTGAAGTCTGC AGG (reversed) Intergenic
No off target data available for this crispr